MG_384 – GTPase1 Obg

Name
WID MG_384 View in model
Name GTPase1 Obg View in model
Symbol obg
Synonyms cgtA, obgE, yhbZ
Protein product MG_384_MONOMER
Cross references GenBank: AAC71611.1, CMR: MG_384, BioCyc: MG_384, SwissProt: P47624
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 479568485870 MG_381 MG_382 MG_383 MG_384 MG_385 MG_386 MG_524 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 482068 (nt), Length: 1302 (nt), Direction: Reverse, G/C content: 30.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
ATGGCTATTACAGATTATTGTGAGTGTCGCTTTACTGCTGGAAATGGTGG
TAATGGAATCATAGCATGAAAAAGAGAAGCACATTATGATAAAGGTGGTC
CTGGTGGTGGTAATGGTGGTAATGGTGGTAATGTTATTTTGCAAGCTGAT
CATAACTGCGATTCACTTTTTTTCTTGAAGAATAAAAAACACCTGTTTGC
AGAAGATGGACAAAATGGTAAACCAGATTTAGCACATGGTAAAAATGGTT
CAGATCTTTTAATTAAAGTGCCAATAGGAACAACAGTTAAAAACTTAGAA
AATAATAGTGTATTGGTGGATTTTGTTCATGATAAACAGAGTTTTATTTT
GTGTTTTGGCGGAAAAGGCGGAAAAGGAAATGCTGCTTTTAAAAGCCCAA
TTATGCGTGCTCCTAATCTATATGAAAATGGTGATAAAGGAGAGATTTTA
AACGTTAGTTTGGAAGTTAAATATTTAGCTAATGTAGGAATTGTTGGTTT
TCCAAATTCAGGTAAATCAACACTAATCTCCAAACTTTCAAATGCCAAAC
CTAAAATTGCAAACTATCGCTTTACTACTTTAATACCCGTACTTGGTGTA
GTTAAATATCAAAATAATAGTTTAGTTTTTGCTGATATTCCTGGTTTGAT
TGAAAATGCTAGTGAAGGAAGTGGGTTAGGACATGATTTTTTACGGCATA
TAGAGAGGTGTGAAATATTAATTCATTTAATTTCACTTGATCCTGTAGAT
AATGATGATCCTTGCAAAGCATATTTACAAATAATGGATGAACTTTCAAA
ATATTCTCCCCTTCTAGTTAAAAAAAAGATGCTTGTTGTAGCTAATAAAA
TTGATGTTAATGAAGGTGAGAAACGGTTTAAAAAATTAGAAAAATTTCTT
CAAAAAAAATCTATTTCTGTATTAAAAATTTCTGCTTTAAAGAAAGAATT
AGGCAATTTACTTGATAGAGTTTTTGAACTTTACAATAAAACAATTTCCC
AATTTGGAGCTAATAAGTTTAGTTTGCCAATGGAACTTGAGAAGCATTAT
GTTTTTCAAAATACCAATGAAAATAATAACGACCCTTTAAATATTGAAAA
AGATAGTTTAAACAGATGAATTGTTAATTGTAAACGTCTAAGATATTGAT
TTGATAAAATTCCACAAACTACGCTTGATAACATTCGTCGCTTAGGAAAT
AAAATTAAAGAAATCGGTATTGAAGATCAATTAAAATCCGTTGGTGCTAA
AAAAGGTGATATTATTTTCTTTGATGGTTGTGAATTTGTAATTAATGACT
AA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1302
View in model
Transcription unit TU_279 View in model
Empirical formula (pH 7.5) H13886C12583N5199O9081P1302
Molecular weight (pH 7.5; Da) 423565.61 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
13611100
pI 4.08
 
Comments
Comments 50S ribosome maturation [PUB_0058, PUB_0104]; chromosome separation [PUB_0104]; may coordinate translation status with replication by linking (p)ppGpp levels to 50S ribosome assembly [PUB_0104]; stabilizes stalled replication forks [PUB_0152]; regulate and coordinate ribosome function, cell cycle activity, and DNA partitioning and segregation [PUB_0182]; possibly involved in incorporation of L33, L34, L16 into 50S ribosome [PUB_0224]; possibly involved in coupling 30S and 50S ribosomal subunits [PUB_0224];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Borges CL, Parente JA, Pereira M, de Almeida Soares CM. Identification of the GTPase superfamily in Mycoplasma synoviae and Mycoplasma hyopneumoniae. Genet Mol Biol 30, 212-218 (2007). WholeCell: PUB_0058, URL: http://www.scielo.br/scielo.php?script=sci_abstract&pid=S1415-47572007000200007&lng=en&nrm=iso&tlng=en

  3. Britton RA. Role of GTPases in bacterial ribosome assembly. Annu Rev Microbiol 63, 155-76 (2009). WholeCell: PUB_0104, PubMed: 19575570

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Jiang M, Datta K, Walker A, Strahler J, Bagamasbad P, Andrews PC, Maddock JR. The Escherichia coli GTPase CgtAE is involved in late steps of large ribosome assembly. J Bacteriol 188, 6757-70 (2006). WholeCell: PUB_0224, PubMed: 16980477

  6. ... 3 more

  7. Peterson JD, Umayam LA, Dickinson T, Hickey EK, White O. The Comprehensive Microbial Resource. Nucleic Acids Res 29, 123-5 (2001). WholeCell: PUB_0182, PubMed: 11125067, URL: http://cmr.jcvi.org/

  8. Potrykus K, Cashel M. (p)ppGpp: still magical?. Annu Rev Microbiol 62, 35-51 (2008). WholeCell: PUB_0152, PubMed: 18454629

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:36