MG_382 – uridine kinase

Name
WID MG_382 View in model
Name uridine kinase View in model
Symbol udk
Protein product MG_382_MONOMER
Cross references GenBank: AAC71609.1, CMR: MG_382, BioCyc: MG_382, SwissProt: P47622
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 478191483833 MG_379 MG_380 MG_381 MG_382 MG_383 MG_384 MG_524 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 480691 (nt), Length: 642 (nt), Direction: Forward, G/C content: 29.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGGATGAAAAAGGGATTTTAGTTGCAATTAGTGGTGGTAGTTGCTCAGG
AAAAACTACTGTTGCTGAAATGATTTATCAACTTTTAAGTAAAAAATTAA
AAGTTGCGATCATCTGTCAAGATAACTATTACAAGTCCTATAAAAATAAG
CCATTATTAAAAAGAAAAACAATAAACTTTGATCATCCTGATGCTTTTGA
TTGAAAACTTTTAAGATCACACATTGAAGATCTTCTAAACGGTAGTATAG
TTAATGTTCCTTTATATGACTACATTAACTATACCAGAGCTAAAAAAACA
GCAAAAATTGGTCCAATTGATGTTGTTATTCTAGAGGGTTTAATGCCATG
ATTTGATGAAAAATTATCAAGACTTTCTAAGCTAAAAATATTTATAGAAA
CAAATGGGGAAGAACGTTTAATTAGAAGAATAGAAAGAGACTGACAAAGG
GGAAGAAATATTGATTCTATTATTAAACAGTGACGCGAAATAGTAGCACC
AATGTATGAAATATTTGTAGAAAAAATGAAGCGAAATGCTGATTTAATTC
TGCCTTGAAGTCAACGCAGAGAAGTAAGTACAAGTGTATTGGATGTCGCA
ATTGAACACTTATTTCACAAAACTGTTGAAAAAAATAATTAG
50
100
150
200
250
300
350
400
450
500
550
600
642
View in model
Transcription unit TU_277 View in model
Empirical formula (pH 7.5) H6871C6228N2634O4428P642
Molecular weight (pH 7.5; Da) 209352.09 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
3.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6768200
pI 3.79
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:35