MG_380 – methyltransferase GidB

Name
WID MG_380 View in model
Name methyltransferase GidB View in model
Symbol gidB
Synonyms rsmG
Protein product MG_380_MONOMER
Cross references GenBank: AAC71607.1, BioCyc: MG_380, CMR: MG_380, SwissProt: P47620
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 476499482078 MG_378 MG_379 MG_380 MG_381 MG_382 MG_383 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 478999 (nt), Length: 579 (nt), Direction: Forward, G/C content: 24.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGAATAATGCTAATTTTGAAAAATATGTTGATTTAGTTTTTGAAGCAAA
CAAAAATTTCAACTTAACAGGATTTAAAACAAAAGAAGCTATTTATCAGA
ATTTAGTTATAGAAATATTGACATTATTTAAAGGATATGAAAAATTTTTT
ATTGACAAAACTGTAGCAGACTTGGGAAGTGGAAATGGTTCGCCTGGGAT
AATATTAAAACTGTTATTTCAAAAAATAAAAAAGTTAGTTTTAATTGATA
GTAAACACAAAAAAATTAGCTTTTTAAATAAATTAACTAAGCAACTAAAT
CTGGAGAAAACTGTTGCAATTTGTGAACGAATTGAAGTACATAAAAATCA
CTATGATGTTATCTGTTCTCGTGGTCTAAGTACGATTATTAAAGTTAATG
ATTTAGCATTTTCCTTGCTTAACTCAAAAGGTATTATTTTTCATATAAAA
CAAAGCTTAGACCAATACATTGAATTTGAAAAATCAAATCAGAAGAATCA
ATTTAACTTGTTATTTATAAAGCACTTTACTAGTCAGAATAAAAAACTAA
TTTTGATAGCTTTACAAAAAAATGATTAA
50
100
150
200
250
300
350
400
450
500
550
579
View in model
Transcription unit TU_275 View in model
Empirical formula (pH 7.5) H6174C5594N2307O4006P579
Molecular weight (pH 7.5; Da) 187751.51 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6140900
pI 3.92
 
Comments
Comments catalyzes m7G527 modification of 16S rRNA [PUB_0105];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Peil L. Ribosome assembly factors in Escherichia coli. Tartu University (2009). WholeCell: PUB_0105, URL: http://dspace.utlib.ee/dspace/handle/10062/10503

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:35