MG_376

Name
WID MG_376 View in model
Protein product MG_376_MONOMER
Cross references GenBank: AAC71603.1, CMR: MG_376, BioCyc: MG_376, SwissProt: P47616
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 472078477393 MG_374 MG_375 MG_376 MG_377 MG_378 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 474578 (nt), Length: 315 (nt), Direction: Reverse, G/C content: 29.8%, Sequence:
1
51
101
151
201
251
301
ATGTTAAATTGCGTTTTTTTGGAAGGTGAAATAGAAAGCACAAAGTGAAG
CCACAAAAAGACAGGATTTTTAGTAACTATTAAGCAGAAACGTTTGTTTG
GTGAACGAAGTTTTACTGATTTTTTTGTTTTTTATGCAAATGGTCAATTA
GCATTTGAACTTGAAGCATATACTCAAAAATTTAAAACAATTAGCATCGA
AGGTATTCTGCGCACTTACCTAGAAAAACGCAGTGGAATTTGAAAAACAA
CAATCGAAGTTGTCAAAATTATGAAACCAAATTCAAAAGTAATGATTGAT
TATCAAGAATCTTAA
50
100
150
200
250
300
315
View in model
Transcription unit TU_272 View in model
Empirical formula (pH 7.5) H3368C3052N1281O2181P315
Molecular weight (pH 7.5; Da) 102645.28 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3282700
pI 3.87
 
Comments
Comments OB protein fold (oligonucleotide/oligosaccharide/oligopeptide binding fold) family[PUB_0191]; most similar in structure to the Escherichia coli PriB [PUB_0191]; bind and stabilize transiently formed single-stranded DNA [PUB_0191];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Das D, Hyun H, Lou Y, Yokota H, Kim R, Kim SH. Crystal structure of a novel single-stranded DNA binding protein from Mycoplasma pneumoniae. Proteins 67, 776-82 (2007). WholeCell: PUB_0191, PubMed: 17348019

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:34