MG_372 – thiamine biosynthesis/tRNA modification protein ThiI

Name
WID MG_372 View in model
Name thiamine biosynthesis/tRNA modification protein ThiI View in model
Symbol thiL
Synonyms thiI
Protein product MG_372_MONOMER
Cross references GenBank: AAC71599.1, CMR: MG_372, BioCyc: MG_372, SwissProt: P47612
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 467577473735 MG_369 MG_370 MG_371 MG_372 MG_373 MG_374 MG_375 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 470077 (nt), Length: 1158 (nt), Direction: Reverse, G/C content: 27.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
ATGGAATTGAATAGTGAAGATGTATTAGTTGCGCGTTATGGTGAATTGGT
TTTAAAAGGAAAAAACCGTTCTTATTTCACAAAACAATTAAAAATTAACA
TCAAAAAAGCTTTTAAAAAACTGGAAATTAACAATAGTATTGTTTATGAA
TTTGATAGAATTGTTGTCTTTGATATTAAAAAAGAACAAAGAGCGATTCT
CCAAGAATTATTCAGTTTTTTGCCTGGAATTAGTTTGTTCTTTTTTGCAT
CACAGATAGTAAGGGAAGAAAACAAACTATTAGATCTTCTTTTTAATTTA
TTTAAAGATTTTAATTCCTTTAAATTAGAAGTTAAGAGACGTGATAAAAA
TTTTGCTGAAAATTCAAGTAATTTTAAGAAGTATTTAGCAGTTAAACTAT
TTGAAAAATACCAATTAAAAGGAGTAATTAATAACCCTGAAATAATAGCT
AATATAGAGATTTTGAAGGAGCATTTTCTTGTTTTTACAGAACGTTTTAA
AGGTAAAGGTGGATTACCTGTTTATAGTAGTGGTAAAGCTTTAGTCTTAC
TTTCAGGAGGAATTGATAGCCCAGTTGCAGCTTCACTTGTAATGCAACGT
GGTTTTAACATTGATTTTATCACCTTTATTAATGAACCAAATAAGAATCA
AAAAACAATTGAAAAAATCACAAGGTTAGCAAATTTAATTTCTTTTAATA
AAACGATTTGTAGTGGTAAATTATTAGTTTTTGATTTCACTGCAATTCAA
AAAGAGTTAATTCATATTAGTAATGAATCTTATCGTATCGTTTTAATGCG
TCGTGTTTTTTATAAAGCTGCTAGTATGTTTAAGTATGATTGTCTAGTTA
CAGGTGAGGTTTTGGGACAAGTTGCATCCCAAACCATTGAAAATTTAAAA
GTTATTCAATCAGCAACACCAGATACATTTATAGTTCGCCCCTTAATTGG
CTTTAGTAAAGATAAAATTATTGAATTAGCTAAATTTTTTAATACTTTTG
ATATTTCTATTGAACAACATTTAGATACTTGTAGTGAGTTTTCTCCCAAA
AATCCTACAACGAAAGCTAAATTGATAAATGTTGAAAAGCTTGAAAGTGA
GCTTATTTTTTTAAATGATTTAATTGAAAAGGGAGTAAGTGAATTAAGCA
ATGATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1158
View in model
Transcription unit TU_271 View in model
Empirical formula (pH 7.5) H12321C11162N4536O8100P1158
Molecular weight (pH 7.5; Da) 375478.96 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
12171800
pI 4.21
 
Comments
Comments catalyzes 4-thiouridination [PUB_0062]; sulfur transferred onto ThiI by IscS [PUB_0062]; modification not required [PUB_0063]; Mycoplasma doesn't contain IscS, contains similar nifS [PUB_0066];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Kambampati R, Lauhon CT. Evidence for the transfer of sulfane sulfur from IscS to ThiI during the in vitro biosynthesis of 4-thiouridine in Escherichia coli tRNA. J Biol Chem 275, 10727-30 (2000). WholeCell: PUB_0063, PubMed: 10753862

  4. Pierrel F, Björk GR, Fontecave M, Atta M. Enzymatic modification of tRNAs: MiaB is an iron-sulfur protein. J Biol Chem 277, 13367-70 (2002). WholeCell: PUB_0062, PubMed: 11882645

  5. Tokumoto U, Kitamura S, Fukuyama K, Takahashi Y. Interchangeability and distinct properties of bacterial Fe-S cluster assembly systems: functional replacement of the isc and suf operons in Escherichia coli with the nifSU-like operon from Helicobacter pylori. J Biochem 136, 199-209 (2004). WholeCell: PUB_0066, PubMed: 15496591

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:26
Last updated 2012-10-01 15:13:34