MG_371 – DHH family protein

Name
WID MG_371 View in model
Name DHH family protein View in model
Protein product MG_371_MONOMER
Cross references GenBank: AAC71598.1, CMR: MG_371, BioCyc: MG_371, SwissProt: Q49428
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 466610472585 MG_369 MG_370 MG_371 MG_372 MG_373 MG_374 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 469110 (nt), Length: 975 (nt), Direction: Reverse, G/C content: 31.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGATTAGTATCGATCCACAATTCATTAAGAATTTTTCAAAAAAGGTTAA
ACAGTTTGATAAGTTCAGTTTATTTGTACATGTAAACCCAGACTTTGATG
CATTTGGATCTGCTTTTGCTTTCAAAACTTTCCTAAATACTTTTTTCAGT
GAAAAAAAAGCTTATGTTATGGGTTCATACAATATTAATGCAGACGGTAG
AGAACTTTTTCCTTTTGAGCAAACTGACATAAATGATGATTTTGTAAAAG
AATCTTTAGCTATTATTTTTGATACTTCCAACCAAGAAAGAGTTTTAACT
CAAAAACATAAGTTGGCAAAAGAGACAGTTAGGATAGATCACCATCCTAG
AACTGAAAAATTTGCTGATATGGAATGAATTGATTCTTCTTTTTCAGCAA
CTGCTGAGATGATTGGTTATTTAATTTTGCAGATGGGTTACAAATTAAAT
GATGAGATTGCATCATATCTTTATGCAGGAATAATTACTGATACACAGCG
ATTCTGAGGTCCAACTACTACACCCCAAACATTTGCCCTAACAGCAAAAT
TGATGGAAACTGGTTTTAACCGCAATAAGGTTCATGATGCAGTTTATTTA
AAGCCATTACTAGAACATAAGTACTTTAGCTATGTACTTAGCAAAGCCAA
AATAACTAAAAATGGGTTAGCTTATGCATTGATTAAAAAAGGAGCATATA
AACATTTTGGTGTTGTCTCTCCTTTACCAATGGTTCATGCTTTGAATAAC
ATAAAAGGAGTAAAAATATGGACTACTGTTTACTTTAACGAGTCCATTAA
AAAATGAATTGGTTCCATTCGCTCACGTAATATTCCAATTAATAACTTTG
CACAAATGTTCAATGGTGGTGGACATAAATATGCAGCTGCTTTTGTTTTG
GATGAAAAAAATCAATTTATGAAATTAGTACAGATAATGGATGATTTTCT
TGCCAAACAAAATGAGAATAGCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
975
View in model
Transcription unit TU_270 View in model
Empirical formula (pH 7.5) H10402C9426N3903O6804P975
Molecular weight (pH 7.5; Da) 317424.56 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
10070500
pI 4.03
 
Comments
Comments Exopolyphosphatase-related proteins [PUB_0110]; DHH phosphoesterase family [PUB_0110]; family includes drosophila prune protein and recJ [PUB_0162]; family has broad spectrum of targets [PUB_0162];
References
  1. Aravind L, Koonin EV. A novel family of predicted phosphoesterases includes Drosophila prune protein and bacterial RecJ exonuclease. Trends Biochem Sci 23, 17-9 (1998). WholeCell: PUB_0162, PubMed: 9478130

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:26
Last updated 2012-10-01 15:13:34