MG_364 – Replication initiation/membrane attachment protein

Name
WID MG_364 View in model
Name Replication initiation/membrane attachment protein View in model
Symbol mob13
Protein product MG_364_MONOMER
Cross references GenBank: AAC71591.1, CMR: MG_364, BioCyc: MG_364, SwissProt: P47604
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 458515464190 MG_360 MG_361 MG_362 MG_364 MG_365 MG_366 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 461015 (nt), Length: 675 (nt), Direction: Forward, G/C content: 29.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGGATGGTGGACAACAAGGGAGTTTTTTTGGGCTTTTAGTAATTGTTAT
TCCAATAATTTTGTTAATTGTTTTTTTTTCCAAGAAAAAAGGGGCACAAA
AAAATGATTTTAGTGGTGAAGGAGGTAATCGATCATCAAGAAAAGATGAA
GTGTGAAAAACAATTAAACAGTTTTTGCAAGAAAAGAATGAACGTGGTAA
AGAAATTATTAAAACTTTTGTAGCTAAAAAACCAAACCCTTTACATTCAA
AAAAAGACCGCAAGCTTTTCAATCAAGAGATACAGGCATATATTACTAGT
AATAACTTAGGAAAAAGCGAAGCAAAACGTTATAAAAATGAGCAAACTCG
CTTAATGCAAAGAGAACTTTATTGTATTTATTTTGTTACAAAAGATGCTA
AATCAACTGAAGTTGATGATGCTAGGATTATAGAAGCTGAGGTTTATCAA
AAACCTACAAAAACCAAAAGTACTCCAGAGCGGCTAATTCGTATACTTGG
TTTAAAAAATTTTGAAACTGAAATGCAATGAATTCAACCATTAATGGTTC
GTGAAGAAAAGAGAAAAGAAAAAGAAGAACAGAAAAAACTTAAATTAGCT
GCAAGAGAACTAAAAAAGAAGAAAAAGAAGAAAATAAAAAAACCAAAAGA
AATCAGAAATCAGAAAAATGTTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
675
View in model
Transcription unit TU_265 View in model
Empirical formula (pH 7.5) H7252C6576N2853O4597P675
Molecular weight (pH 7.5; Da) 220709.33 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7180000
pI 3.55
 
Comments
Comments homologous to Oenococcus oeni mobilization protein mobC [PUB_0057]; mobC involved in conjugal transfer of plasmids [PUB_0174]; part of relaxase family of strand separating proteins [PUB_0174]; 0.0% horizontally acquired DNA present in M. genitalium [PUB_0175];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Fraser CM, Gocayne JD, White O, Adams MD, Clayton RA, Fleischmann RD, Bult CJ, Kerlavage AR, Sutton G, Kelley JM, Fritchman RD, Weidman JF, Small KV, Sandusky M, Fuhrmann J, Nguyen D, Utterback TR, Saudek DM, Phillips CA, Merrick JM, Tomb JF, Dougherty BA, Bott KF, Hu PC, Lucier TS, Peterson SN, Smith HO, Hutchison CA 3rd, Venter JC. The minimal gene complement of Mycoplasma genitalium. Science 270, 397-403 (1995). WholeCell: PUB_0057, PubMed: 7569993

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Ochman H, Lawrence JG, Groisman EA. Lateral gene transfer and the nature of bacterial innovation. Nature 405, 299-304 (2000). WholeCell: PUB_0175, PubMed: 10830951

  5. Siezen RJ, Renckens B, van Swam I, Peters S, van Kranenburg R, Kleerebezem M, de Vos WM. Complete sequences of four plasmids of Lactococcus lactis subsp. cremoris SK11 reveal extensive adaptation to the dairy environment. Appl Environ Microbiol 71, 8371-82 (2005). WholeCell: PUB_0174, PubMed: 16332824

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:26
Last updated 2012-10-01 15:13:33