MG_362 – ribosomal protein L7/L12

Name
WID MG_362 View in model
Name ribosomal protein L7/L12 View in model
Symbol rplL
Protein product MG_362_MONOMER
Cross references GenBank: AAC71588.1, BioCyc: MG_362, CMR: MG_362, SwissProt: P36255
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 457626462995 MG_359 MG_360 MG_361 MG_362 MG_364 MG_365 MG_366 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 460126 (nt), Length: 369 (nt), Direction: Forward, G/C content: 34.7%, Sequence:
1
51
101
151
201
251
301
351
ATGGGAAAACTAGATAAAAAACAATTAATTGAATCTCTAAAAGAGATGAC
TATAGTTGAAATTGATGAAATAATCAAGGCTGTTGAAGAAGCATTTGGTG
TAACTGCAACTCCAATAGTAGCTGCTGGCGCAGCTGGTGCTACACAAGAA
GCTGCTAGCGAAGTTAGTGTAAAGGTAACAGGATATGCTGATAATGCTAA
GTTAGCTGTTTTAAAACTTTATCGTGAAATTACTGGAGTTGGTTTAATGG
AAGCTAAAACTGCAGTTGAAAAATTACCTTGCGTTGTAAAACAAGATATT
AAACCAGAAGAAGCAGAAGAACTTAAAAAGCGTTTTGTTGAAGTTGGTGC
AACTGTTGAAGTTAAATAA
50
100
150
200
250
300
350
369
View in model
Transcription unit TU_263 View in model
Empirical formula (pH 7.5) H3958C3588N1539O2547P369
Molecular weight (pH 7.5; Da) 120819.78 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3836900
pI 3.76
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:26
Last updated 2012-10-01 15:13:32