MG_361 – ribosomal protein L10

Name
WID MG_361 View in model
Name ribosomal protein L10 View in model
Symbol rplJ
Protein product MG_361_MONOMER
Cross references GenBank: AAC71587.1, BioCyc: MG_361, CMR: MG_361, SwissProt: P36263
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 457115462604 MG_359 MG_360 MG_361 MG_362 MG_364 MG_365 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 459615 (nt), Length: 489 (nt), Direction: Forward, G/C content: 30.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGGTAGATAGTAAGAAAAATAAAAAACAGCAGGTTACGGATTTTTCTAA
TTTACTCTCTCAAAGTAAAGGATTTGTTATTTTTGACTATTCAGGAATGT
CTGCTGTTGATGCAACTTTAATGAGAAAAAAGTTGTTTAATAAGGGTAGT
AAGATAAAAATTGTTAAAAACAATATCTTAAGACGTGCTTTAAAAACTAG
TAATTTTGAAGGTGTTGATGAATCGGTCATCAAAGGAAAAATTGCAGTTG
CTGTTGGTATTAACGAGATCTTAGAAACCTTAAAAGTTGTTGATAGTGTA
GTTAAAGAAAAAGAGTTAATGAAATTTGTTTGTGGTCATTTTGATAACCG
TATTTTTAATAGTGATGACTTACAAAAAATAGCAAAACTCCCTGGTAGAA
ATGAACTTTATGGAATGTTTCTTTCAGTTCTACAAGCACCATTACGAAAA
TTTCTCTATGCTCTTCAGGCAGTAAGGAATGCTAAGTAA
50
100
150
200
250
300
350
400
450
489
View in model
Transcription unit TU_263 View in model
Empirical formula (pH 7.5) H5217C4727N1956O3408P489
Molecular weight (pH 7.5; Da) 159102.04 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
3.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5115000
pI 4.07
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:26
Last updated 2012-10-01 15:13:32