MG_360 – ImpB/MucB/SamB family protein

Name
WID MG_360 View in model
Name ImpB/MucB/SamB family protein View in model
Symbol dinB
Synonyms umuC
Protein product MG_360_MONOMER
Cross references GenBank: AAC71585.1, CMR: MG_360, BioCyc: MG_360, SwissProt: Q49426
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 455760461996 MG_358 MG_359 MG_360 MG_361 MG_362 MG_364 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 458260 (nt), Length: 1236 (nt), Direction: Reverse, G/C content: 25.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
ATGATTAACACCTTTACATATTTTGAACCAGAATATTTAATTGATAAAAA
TTTAATTTTTCTTTATTTTGATTTTGATGCTTTTTTTGCATCTGTTGAAG
AATTAGAAAATCCAGAATTAGTTAATCAACCCTTAATAGTTGGTAATCGC
TTTTCAAGAAGTGTAGTTTCAACTTGTAACTATGTTGCTCGTAGTTATGG
AATTAGATCTGGAATGTCTATTTTAAAAGCATTAGAACTATGTCCAAATG
CTATTTTTGCACATTCTAATTTTCGTAATTACAGAAAACATTCTAAACGT
ATTTTTTCAGTTATTGAAAGCACTTTTTCATTAAAAATTGATGTTCTTTC
TGTTGATGAAGGGGTTGCTTGTTTTCAAAACATTTCATTTAAAAAGGCAT
TTTTAATAGCGAAAAAAATAAAAAATTTTGTTTTTCAAAACTTGAGAATC
AAAATTTCAATTGGCATCTCAGATCATTTTTTAATTGCTAAGATTTTTTC
AAATCAAGCAAAACCATTTGGAATTAAAAGTTGTTCAGTTAAGGATATTA
AAAAAAAACTTTGACCACTACCAATTACTGAAATTCCAGGGATAGGAGAA
AAACATATTGATTTAGTTTTTAAAAATAATTTTTACAAAATAAATGATCT
AGCAGTTTGTGAAGATGCTTCGCTTTTAAAAAAAGTATTTGGTAATTTTT
GAGAATCTTTAAAAGCAGTTTCACTAGGCAAATGATATACAGATAATAAC
AATCAGGTTAAGTCTCGCTCTTTTGCAGTCAGTGAAACGTTAGAAGATTT
AAATTATTCAAACAATCAGTTAAATAAAAAGTTAACGCAAATATTTGATC
AGCTCTTTATAAGATTACAACTCTCTTCACAAGTGTGTAAAGGGATAGTT
GTGCAATTGAAAAGCAATGATTTTATTGTTAATTCTCATTCAAATAAAAT
GAAAAAATATTCAAACGATTATAGAAAACTACTGTCAATAACAAAACGAT
TATTCAACAGACTATTAATTAATACTGAAAAGAACGTTCGATTAATAGGT
ATTAGTTTTTTTGATTTAAAAAAGATAGATACAGATGAAGGACAGAAAAA
ATCTTTATTTTATCAATTCATACCAAAATCAATTAGCAAATTAAGCGAAG
AATCTTCACTTGATAAATTAATTTTTGATATTAATGAAAGTTTTGGTTTT
GAAATTATTAAAAGAGCTAATAAGCTTAAAAGTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1236
View in model
Transcription unit TU_262 View in model
Empirical formula (pH 7.5) H13148C11911N4833O8629P1236
Molecular weight (pH 7.5; Da) 400348.14 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.6 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
12983300
pI 4.13
 
Comments
Comments low fidelity DNA polymerase [PUB_0136]; translesion DNA synthesis [PUB_0136]; activated by umuD, recA, SSB [PUB_0137]; polymerizes 1 base per binding event [PUB_0138]; mismatch incorporation rate 100-1000 X slower than correct match incorporation rate [PUB_0139]; allows cells to survive in the presence of relatively high levels of replication-inhibiting DNA damage, but at the cost of an increased mutation rate [PUB_0140];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Fiala KA, Suo Z. Pre-steady-state kinetic studies of the fidelity of Sulfolobus solfataricus P2 DNA polymerase IV. Biochemistry 43, 2106-15 (2004). WholeCell: PUB_0139, PubMed: 14967050

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Ohmori H, Friedberg EC, Fuchs RP, Goodman MF, Hanaoka F, Hinkle D, Kunkel TA, Lawrence CW, Livneh Z, Nohmi T, Prakash L, Prakash S, Todo T, Walker GC, Wang Z, Woodgate R. The Y-family of DNA polymerases. Mol Cell 8, 7-8 (2001). WholeCell: PUB_0136, PubMed: 11515498

  5. Reuven NB, Arad G, Maor-Shoshani A, Livneh Z. The mutagenesis protein UmuC is a DNA polymerase activated by UmuD', RecA, and SSB and is specialized for translesion replication. J Biol Chem 274, 31763-6 (1999). WholeCell: PUB_0137, PubMed: 10542196

  6. ... 3 more

  7. Tang M, Shen X, Frank EG, O'Donnell M, Woodgate R, Goodman MF. UmuD'(2)C is an error-prone DNA polymerase, Escherichia coli pol V. Proc Natl Acad Sci U S A 96, 8919-24 (1999). WholeCell: PUB_0140, PubMed: 10430871

  8. Wagner J, Gruz P, Kim SR, Yamada M, Matsui K, Fuchs RP, Nohmi T. The dinB gene encodes a novel E. coli DNA polymerase, DNA pol IV, involved in mutagenesis. Mol Cell 4, 281-6 (1999). WholeCell: PUB_0138, PubMed: 10488344

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:26
Last updated 2012-10-01 15:13:32