MG_352 – Holliday junction endonuclease

Name
WID MG_352 View in model
Name Holliday junction endonuclease View in model
Symbol recU
Synonyms ruvC
Protein product MG_352_MONOMER
Cross references GenBank: AAC71577.1, BioCyc: MG_352, CMR: MG_352, SwissProt: Q49422
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 447722453223 MG_350 MG_351 MG_352 MG_353 MG_354 MG_355 MG_521 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 450222 (nt), Length: 501 (nt), Direction: Forward, G/C content: 29.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGATAAATGCCAATCGCGGAATGCTTTTAGAGACAATTGTTAATCAAAC
AATTGCTAGGTTAAAGGATCATCCAGATATTTGACTGGAAAAGCGGTTCT
TACCTATTAAGCCTATAGCTTTTCGTCATGCTCATGTATCTGGCAACGTA
TCACAAAAATCAAAAACTGATTATTATGGAATTTACAAGGGAATGTATTT
TGATTTTGAAGCAAAACAAACAAATAAAAGTAATTTTCCAATTGCTCAAA
TAGCAGAACACCAATTAAATCATTTGAAAAGAATTGACCAAATTGGAGGA
GTTAGCTTCTTGCTAATTTACTTTCAAACTAAAGATCAAATTTTTGCATT
TCACACTAAGGATCTTCTAGAAACAATAAAAAATCAAGAAAGCAAAACAA
TTAAAAGGGAATTGATAGAACAAAAATCTCAGAAAGTTCCACTATTGTAT
CCTGGTATTATTGATTTAATTTCAATAATTCAAAGCTTTAAAAATTATTA
G
50
100
150
200
250
300
350
400
450
500
501
View in model
Transcription unit TU_255 View in model
Empirical formula (pH 7.5) H5358C4856N2043O3462P501
Molecular weight (pH 7.5; Da) 163247.77 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5215900
pI 3.80
 
Comments
Comments RuvC is an endonuclease that resolves Holliday junctions (HJ), producing two nicked dsDNA species which can be directly repaired by DNA ligase [PUB_0539]. HJ resolvases are typically small, homodimeric, metal-dependent enzymes [PUB_0539]. recU belongs to nuclease superfamily of HJ resolvases whereas ruvC belongs to the integrase superfamily [PUB_0539]. RuvC binds Holliday junctions with high specificity [PUB_0539]. RuvC preferentially resolves Holliday junctions at the sequence 5'-(A/T)TT↓(G/C)-3' [PUB_0532]. RuvC resolves Holliday junctions with rate 0.209 1/min [PUB_0540]. RuvC is hypothesized to cleave HJs with an SN2-like mechanism [PUB_0539]. The exact mechanism of HJ cleavage is unknown [PUB_0539]. It is hypothesized that one metal ion acts as a base to deprotonate the water molecule, while the second metal ion coordinates a water molecule to protonate the leaving 3’-oxyanion group [PUB_0539]. Both metal ions are hypothesized to stabilize the negatively charged pentavalent transition state [PUB_0539].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Dawid A, Croquette V, Grigoriev M, Heslot F. Single-molecule study of RuvAB-mediated Holliday-junction migration. Proc Natl Acad Sci U S A 101, 11611-6 (2004). WholeCell: PUB_0532, PubMed: 15292508

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Osman F, Gaskell L, Whitby MC. Efficient second strand cleavage during Holliday junction resolution by RuvC requires both increased junction flexibility and an exposed 5' phosphate. PLoS One 4, e5347 (2009). WholeCell: PUB_0540, PubMed: 19399178

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  6. Whitby MC. Eds Aguilera A, Rothstein R. Holliday Junction Resolution. Springer Berlin: Heidelberg 169-199 (2007). WholeCell: PUB_0539, ISBN: 9783540710202

 
Metadata
Created 2012-10-01 15:07:25
Last updated 2012-10-01 15:13:31