MG_347 – tRNA (guanine-N(7)-)-methyltransferase

Name
WID MG_347 View in model
Name tRNA (guanine-N(7)-)-methyltransferase View in model
Symbol trmI
Synonyms trmB
Protein product MG_347_MONOMER
Cross references GenBank: AAC71572.1, CMR: MG_347, BioCyc: MG_347, SwissProt: P47589
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 441913447546 MG_345 MG_346 MG_347 MG_348 MG_349 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 444413 (nt), Length: 633 (nt), Direction: Forward, G/C content: 25.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
GTGCGCTTAAGAAAAGTTAAAAACGCTCTTTTAAAAATTAATCAAAGTCC
TTATTTTTATTCAAAAGATAAGTTTGCTAAGTTTACTAAAAAACAATTAG
TGCTGGAATTGGGTTGTGGTAAGGGTACTTTTTTAATCAAAGAAGCACAA
AAAAATAACAATTTTCTTTTTATAGGAATTGAACGTGAACCTACAATTGT
TTTAAAAGCAATTAACAAAATTAACAAGTTGGATTTTAATTTGGAAAATA
TCTTATTGTTGTGTACAGATGCAAAACAACTTGATGATTATTTTCAAGCT
GAATCTGTTCAAAAAATCTTTATTAATTTCCCTGATCCTTGACCTAAAAA
GCGTCATATACAAAGACGTCTAACAAGTCCAGATTTTTTGAAACTTTTTT
GAAATTTACTAGTAAAAAATGGCTTAATTGAGTTTAAGACTGATAATGAT
AAGTTATTTGAATATACTTTAACAACATTGCAAGAAAATAGTCAAATTTT
TGAAATTATCCATCAAATAACTGATCTTAACAATTCTGAATTCAGTTTTC
AAAATAGTATCACTGAATATGAACAGCGCTTTATGGAATTAGAAATTCCA
ATTAAAAAACTAGTGATTAAGAAAATAATTTAA
50
100
150
200
250
300
350
400
450
500
550
600
633
View in model
Transcription unit TU_247 View in model
Empirical formula (pH 7.5) H6745C6111N2508O4400P633
Molecular weight (pH 7.5; Da) 205328.25 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
3.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6637500
pI 3.99
 
Comments
Comments catalyzes position 46 (m7G46) in tRNA with 44-48 sequence NNGPyPy where N={A,C,G,T}, Py={C,T} [PUB_0052]
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Matsumoto K, Toyooka T, Tomikawa C, Ochi A, Takano Y, Takayanagi N, Endo Y, Hori H. RNA recognition mechanism of eukaryote tRNA (m7G46) methyltransferase (Trm8-Trm82 complex). FEBS Lett 581, 1599-604 (2007). WholeCell: PUB_0052, PubMed: 17382321

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:25
Last updated 2012-10-01 15:13:30