MG_346 – 23S rRNA methyltransferase; U2552

Name
WID MG_346 View in model
Name 23S rRNA methyltransferase; U2552 View in model
Symbol yibK
Protein product MG_346_MONOMER
Cross references GenBank: AAC71571.1, CMR: MG_346, BioCyc: MG_346, SwissProt: P47588
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 441422446923 MG_345 MG_346 MG_347 MG_348 MG_349 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 443922 (nt), Length: 501 (nt), Direction: Forward, G/C content: 28.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGTATAAATCAGTAATAAACATAGTTTTATTTTGTCCAGAAATTCCTAA
TAACACTGGCAACATCGTACGTAGTTGCACTGCTTTTAAAGCTAATCTAC
ACTTAATTAAACCTTATGGCTTTTTCTTAAATGATAAAAGGATGGTTAGA
GCTGGTTTAAATTGTTGAGATAAAATTCAATTATTTGAACACAAATCATG
AGAACATTTCTTACAAGCAACCACTGAAAATAAAACTATTTGGCTTTTAA
CTAAAAGTGGTGATAAAACTCCTGATCAAATTTGCATGACAAATAAATTA
CCAAACGAACTTTACTTTGTTTTTGGTCAGGAAACAAAGGGATTACCTAA
AACAATCATGGATAACTTTAAACAAAACCAAATTAGAATTCCCATTTGAA
ATAGTGTTAGAAGTATTAATCTTGCTAATGCAGTTGTCTGTATTTTGTAT
GAATATTCAAAGCAAAATCAATACTCTAATTTAGATAAACAGTGCGCTTA
A
50
100
150
200
250
300
350
400
450
500
501
View in model
Transcription unit TU_247 View in model
Empirical formula (pH 7.5) H5347C4845N2010O3481P501
Molecular weight (pH 7.5; Da) 162946.34 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5192700
pI 3.93
 
Comments
Comments catalyzes 2'-O methyltransfer of 23S rRNA U2552 => Um [PUB_0120];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Gustafsson C, Reid R, Greene PJ, Santi DV. Identification of new RNA modifying enzymes by iterative genome search using known modifying enzymes as probes. Nucleic Acids Res 24, 3756-62 (1996). WholeCell: PUB_0120, PubMed: 8871555

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:25
Last updated 2012-10-01 15:13:30