MG_339 – recombination protein, strand exchange

Name
WID MG_339 View in model
Name recombination protein, strand exchange View in model
Symbol recA
Protein product MG_339_MONOMER
Cross references GenBank: AAC71564.1, CMR: MG_339, BioCyc: MG_339, SwissProt: P47581
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 424590430544 MG_338 MG_339 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 427090 (nt), Length: 954 (nt), Direction: Reverse, G/C content: 31.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
TTGACAAGTTTTGATTTTTTTGATGCAAAGAAAAACAGTGAAATTGAAAC
AATTTCAACTGGAAGTTTAAATTTAGATGAAGCATTAGGGTCTGGTGGTC
TACCTTTAGGTAGGATAGTAGAACTATATGGAAATGAATCATCTGGAAAA
ACAACTATTGCACTAAATGCAGTCGCTAGTTTTCAGAAAGCAGGTAAAAC
AGCATGTTATATTGATGCTGAAGGTGCACTTGATTTAGCATATGCTAAAT
CAATTGGTATTGATCTAAATAAACTTTTGATTGCTCATCCTAGGCATGGT
GAAAACGCTTTTGCTCTTATCGAATCATTAATTAAAACAAACAAGATATC
TTTAATTGTTATTGACTCTGTAGCAGCGTTAATTCCTAAACAAGAGTTAG
AAGGCACAATTGAAGAACAAACTATTGGCTTGCATGCAAGAATGATGTCA
AAAGGTTTGCGAAGAATACAATCGATATTACCAGATTCTAAAACTTGTGT
TTTATTCATTAATCAGTTACGCGAAAAACCAGGAGTGATGTTTGGAAATA
ACGAAGTTACAACAGGAGGAAAAGCTCTAAGATTTTATAGTTCATTAAGA
ATGGAAGCTAAGCGTGTTGAATTACTTAAGGATAAATTCAACAATTATGT
TGGCATAAAAACAAAAGTAATGGTATCTAAAAATAAGATTGCTAAACCTT
TTGGTGTTGCTATATTAGAAATCATGTTTAACCGTGGTTTTGTACATGAA
CATGAAGTTATTGACTTAGCACTTAAATTTAATGTTGTTGTAAGAGCTGG
AAATTCTTATTCTTTTAACAATGAAAGCATTGCTGTTGGTAAAGAAAAAT
TATTAAATGTTTTATCAGAAAAGCCAGCATTATTTGAACAAATAAAAGAA
CTAACTGTTCAACAATTGGCTAATAAAAATTCATTTCAACAAACAGCTAG
CTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
954
View in model
Transcription unit TU_241 View in model
Empirical formula (pH 7.5) H10192C9237N3861O6627P954
Molecular weight (pH 7.5; Da) 310872.25 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9952600
pI 3.94
 
Comments
Comments Binds 3' ssDNA overhangs [PUB_0072]. Approximately one monomer binds ssDNA per 3 nt [PUB_0082]. Initial DNA binding promoted by SSB, then displaces SSB [PUB_0082]. Subsequent binding is cooperative and forms sprial filament [PUB_0082]. Aligns homologous DNA, and executes strand exchange forming Holliday junctions [PUB_0082]. ATP-hydrolysis appears to be required for strand exchange, although the exact energetic coupling of ATP hydrolysis to strand exchange is unknown [PUB_0529]. Strand exchange kinetics have been studied by Bazemore et al (0.05-0.07 1/s) [PUB_0528], Xiao et al (0.053-0.42) [PUB_0529], and Bhattacharyya et al (0.082 1/min) [PUB_0530]. Knockouts grew faster than wild-type [PUB_0193].
References
  1. Bazemore LR, Takahashi M, Radding CM. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. J Biol Chem 272, 14672-82 (1997). WholeCell: PUB_0528, PubMed: 9169430

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Bhattacharyya MK, Bhattacharyya nee Deb S, Jayabalasingham B, Kumar N. Characterization of kinetics of DNA strand-exchange and ATP hydrolysis activities of recombinant PfRad51, a Plasmodium falciparum recombinase. Mol Biochem Parasitol 139, 33-9 (2005). WholeCell: PUB_0530, PubMed: 15610817

  4. Carvalho FM, Fonseca MM, Batistuzzo De Medeiros S, Scortecci KC, Blaha CA, Agnez-Lima LF. DNA repair in reduced genome: the Mycoplasma model. Gene 360, 111-9 (2005). WholeCell: PUB_0072, PubMed: 16153783

  5. Cox MM. Recombinational DNA repair in bacteria and the RecA protein. Prog Nucleic Acid Res Mol Biol 63, 311-66 (1999). WholeCell: PUB_0082, PubMed: 10506835

  6. ... 3 more

  7. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  9. Xiao J, Lee AM, Singleton SF. Direct evaluation of a kinetic model for RecA-mediated DNA-strand exchange: the importance of nucleic acid dynamics and entropy during homologous genetic recombination. Chembiochem 7, 1265-78 (2006). WholeCell: PUB_0529, PubMed: 16847846

 
Metadata
Created 2012-10-01 15:07:25
Last updated 2012-10-01 15:13:29