MG_337

Name
WID MG_337 View in model
Protein product MG_337_MONOMER
Cross references GenBank: AAC71562.1, CMR: MG_337, BioCyc: MG_337, SwissProt: P47579
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 420197425614 MG_336 MG_337 MG_338 MG_517 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 422697 (nt), Length: 417 (nt), Direction: Forward, G/C content: 23.3%, Sequence:
1
51
101
151
201
251
301
351
401
ATGGATATTAGAGCAAGAACAAAAATTATTGATATTTATTCAAATTTAAA
ATACAAAAAACCTCTCAAAAGTTTTCAAAAAATTTTAACAACAAGTGATA
GTGATAATTGTGAAGACTTTTTTAATATAGGTTTAAATATTGATAAAAAT
AAAATTACTGCAATTGGTTTTGATGGTGATGGTTGTATTATCTCTACAAT
TGCAACTGAATTAAGTATTAAAGCAATTGAAAATAAAACTATTAACCAAG
CAAAAAAAATATTATCAGATTTAATTGCAACTTATAAAGATAAAAATTCA
GCAAACCAAGTTGTTGAAGAATTAAAGCTTTTAATTGAAATGAATGTAAC
TGAAAAAAGGTTACAGTGTTTGCTTTTAACACCAAGCAACTTATTGCAAT
GGTTTAAAAATTTTTAG
50
100
150
200
250
300
350
400
417
View in model
Transcription unit TU_239 View in model
Empirical formula (pH 7.5) H4449C4031N1668O2878P417
Molecular weight (pH 7.5; Da) 135224.80 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4431100
pI 3.87
 
Comments
Comments NifU-like N terminal domain [PUB_0110]; nif genes are responsible for nitrogen fixation, but are also found in bacteria that do not fix nitrogen [PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:25
Last updated 2012-10-01 15:13:29