MG_335 – GTP-binding protein engB, putative

Name
WID MG_335 View in model
Name GTP-binding protein engB, putative View in model
Symbol engB
Synonyms yihA, ysxC
Protein product MG_335_MONOMER
Cross references GenBank: AAC71558.1, CMR: MG_335, BioCyc: MG_335, SwissProt: P47577
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 416970422546 MG_334 MG_335 MG_336 MG_517 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 419470 (nt), Length: 576 (nt), Direction: Reverse, G/C content: 27.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGGATGCACATTTTTTGAAGAGTGCAAGTGATTTAAAAGATTGTCCTCA
AGATAATATCCCAGAGATTTGTTTCATGGGAAGAAGTAATGTTGGTAAAT
CAAGTTTGATTAATGCTTTTTTTAAAAAGAAACTGGCTAAAACTTCAGCA
ACACCAGGTCGAACACAATTACTAAATTACTTTGAATATAAAGACAAAAG
ATTTGTTGATTTACCAGGTTATGGCTTTGCTAAAATAAACAAAAATAAGA
AAGATTTTATTACTAATTTACTTACCCAATTTTTAAATTTTCGTAGTAAT
CTAGTTGGTGTTGTTTTGATAGTAGATAGTGGAGTTGTTACTGTTCAAGA
TCAGGAAGTGGTTAAAATTATTTTGCAAACAGGATTGAACTTTTTGATTG
TTGCTAATAAATTTGACAAACTAAATCAAAGTGAAAGATATTTTTCGCTT
AAGAATATTGCAAATTTTTTAAAAGTTAATTTTGATAAATGTGTTTTTGC
AAGTACAAAAACACATCATAATCTTGCTTTAGTTCACAAAAAAATTTTCG
AATTATTCGTTGAAGATGAAAGATAA
50
100
150
200
250
300
350
400
450
500
550
576
View in model
Transcription unit TU_235 View in model
Empirical formula (pH 7.5) H6131C5554N2262O4026P576
Molecular weight (pH 7.5; Da) 186824.51 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
3.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6034100
pI 4.18
 
Comments
Comments protein biosynthesis [PUB_0058]; ribosome biosynthesis [PUB_0110]; B. subtilis ortholog necessary for cell division and septation [PUB_0182]; helps incorporate L16, L26, and L36 into 50S ribosome [PUB_0223, PUB_0104];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Borges CL, Parente JA, Pereira M, de Almeida Soares CM. Identification of the GTPase superfamily in Mycoplasma synoviae and Mycoplasma hyopneumoniae. Genet Mol Biol 30, 212-218 (2007). WholeCell: PUB_0058, URL: http://www.scielo.br/scielo.php?script=sci_abstract&pid=S1415-47572007000200007&lng=en&nrm=iso&tlng=en

  3. Britton RA. Role of GTPases in bacterial ribosome assembly. Annu Rev Microbiol 63, 155-76 (2009). WholeCell: PUB_0104, PubMed: 19575570

  4. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 3 more

  7. Peterson JD, Umayam LA, Dickinson T, Hickey EK, White O. The Comprehensive Microbial Resource. Nucleic Acids Res 29, 123-5 (2001). WholeCell: PUB_0182, PubMed: 11125067, URL: http://cmr.jcvi.org/

  8. Schaefer L, Uicker WC, Wicker-Planquart C, Foucher AE, Jault JM, Britton RA. Multiple GTPases participate in the assembly of the large ribosomal subunit in Bacillus subtilis. J Bacteriol 188, 8252-8 (2006). WholeCell: PUB_0223, PubMed: 16997968

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:25
Last updated 2012-10-01 15:13:28