MG_333 – FMN-dependent NADH-azoreductase, putative

Name
WID MG_333 View in model
Name FMN-dependent NADH-azoreductase, putative View in model
Symbol azoR
Protein product MG_333_MONOMER
Cross references CMR: MG_333, BioCyc: MG_333
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 413837419431 MG_329 MG_330 MG_331 MG_332 MG_333 MG_334 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 416337 (nt), Length: 594 (nt), Direction: Reverse, G/C content: 30.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGAAGAAAGTTATTATTGTTGATGCTTCTGTAACCCCTTCTGGTTCTTA
CACCCACCTTTTATTAGATCGTTTCCTTCAAACTTATAAAAAACAAAATA
GTAGTGTTGAATTTATTGATTGAAATTTAAATGAATTACCAGTAGGTAAG
ATATCTTATAATACCCAAAACGCTAGTAATTTTTTTAGTTTTGAAAATAG
TGATTATTATATTGATGCTCTAAAAACAGCTTATGGAATTGTTATCCTTG
CACCAATGACCAACTTTAATTATCCTGCTAGTTTAAAAAACTTTATTGAT
CATGTCTTTGTAGCTAATAAAACCTTTCAAGACAAATATGTTACTAAAGG
TGCTTCTAAGGGATTACTTACTAATCTTAAGGTAGTTGTTTTAGCGTCAC
AAGGTGCACCATTAGGATGATACCCTTGAGCTGATCATGTTAGTAATTTA
AAGGGCTTGTTTGGTTTTGCAGGTGTTACACATTTTGAGAGTGTTTTAAT
TGATGACACTAAAATTCTTTACAAAGATAAAAACAAGCAAGAGGTAGTTG
ATCTGTTTGCACACAAAGTTGACCAAGTTGCTAATAATTTTTAA
50
100
150
200
250
300
350
400
450
500
550
594
View in model
Transcription unit TU_233 View in model
Empirical formula (pH 7.5) H6318C5723N2319O4180P594
Molecular weight (pH 7.5; Da) 192862.61 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6106900
pI 4.31
 
Comments
Comments FMN-dependent NADH-azoreductase [PUB_0096]; catalyze reductive cleavage of azo groups (-N=N-) under mild conditions [PUB_0231]; reduces electrophilic quinones [PUB_0232]; electrophilic quinones can form S-adducts through covalent bonds with cellular thiols by Michael addition, which depletes cellular thiols and causes thiol-specific stress in cells [PUB_0232];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Liu G, Zhou J, Fu QS, Wang J. The Escherichia coli azoreductase AzoR Is involved in resistance to thiol-specific stress caused by electrophilic quinones. J Bacteriol 191, 6394-400 (2009). WholeCell: PUB_0232, PubMed: 19666717

  4. Nakanishi M, Yatome C, Ishida N, Kitade Y. Putative ACP phosphodiesterase gene (acpD) encodes an azoreductase. J Biol Chem 276, 46394-9 (2001). WholeCell: PUB_0231, PubMed: 11583992

  5. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:25
Last updated 2012-10-01 15:13:28