MG_330 – cytidylate kinase

Name
WID MG_330 View in model
Name cytidylate kinase View in model
Symbol cmk
Protein product MG_330_MONOMER
Cross references GenBank: AAC71554.1, CMR: MG_330, BioCyc: MG_330, SwissProt: P47572
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 411823417477 MG_328 MG_329 MG_330 MG_331 MG_332 MG_333 MG_334 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 414323 (nt), Length: 654 (nt), Direction: Reverse, G/C content: 30.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGAATTGACAAATAGCAATTGATGGTCCAAGTAGTTCTGGAAAGTCCAG
TGTTGCTAAAAAAATAGCTGAAGAACTTGATTTTTTTTATTTTTCTAGTG
GAAAAATGTATCGTGCCTTTGCCTATGTAATGCAAGTGAATAGATTAAAT
ATTGATCTTTTTTTAAAAATCATTAATCAAATTAACTGACGCTTTGAGAA
AGATGCTGTGTATTATAACAATGCTGATATTACAACAGTTATTACAACCC
AATCAGTTGCTAACATTGCTAGTAAAATAGCTGTTGATCCTAACATTAGA
AAAATTGCAGTTATTAAACAACAGAAACTAGCAGAAAATAAAAACATAGT
GATGGATGGTAGAGACATAGGAACAGTAGTTTTAAAAAATGCTCAATTGA
AGTTTTTTTTAGATGCTAAAGTTGAAATTAGAGCGCAGCGAAGATTACAA
GATATGGGAATTTCTCTATCAAATGAAAAAAAACTAAAGGAACTAATTCA
AGAATTAAAGCAACGTGATCAAATTGATAGTTCTAGAACTGCAGACCCAT
TAAAAAAAGCCCAGGACGCTATTTATCTTGACACTTCTGAACTAAGTTTT
GATGCAGTAGTAAAACAAACCCTCAAAGAAGCAAAGAAGGTTTTTAAACT
TTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
654
View in model
Transcription unit TU_233 View in model
Empirical formula (pH 7.5) H6999C6344N2682O4517P654
Molecular weight (pH 7.5; Da) 213342.30 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6840200
pI 3.80
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:28