MG_329 – GTP-binding protein engA

Name
WID MG_329 View in model
Name GTP-binding protein engA View in model
Symbol engA
Synonyms yfgK, yphC
Protein product MG_329_MONOMER
Cross references GenBank: AAC71553.1, BioCyc: MG_329, CMR: MG_329, SwissProt: P47571
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 410473416820 MG_328 MG_329 MG_330 MG_331 MG_332 MG_333 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 412973 (nt), Length: 1347 (nt), Direction: Reverse, G/C content: 31.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
GTGTTTACTGTTGCAATAATAGGTCGTACAAACGTTGGTAAATCAACTTT
ATTTAATCGCTTAATTCAAAAGCCAATGGCTATTGTTTCAGATACTCCTA
ACACGACAAGAGATAGGATCTTTGGAATTGGTGAATGGTTAAAAAGAAAG
ATAGCTTTTATTGACACAGGTGGATTAATTGCAAAACAAACTCCCTTGCA
ACAACTAATTGCATTACAAGTACAAGCAGCACTTAGTCAAGCCAAAGCTA
TTATTTTTTTAGTGTCACTACAAGAACAACTAAATAGCGATGATTTTTAT
GTAGCTAAGGTTCTTAAAAAAAATAAGGATAAACCAGTAATACTAGTGGT
AAATAAAGCTGAAAATTTTAACCCTAAAACTGCTGAAGAAACATTAAAAG
ATTATTACAGCTTAGGGTTTGGAAGACCAGTTGTTATTAGTGCTGCTCAT
GGAATTGGAATTGGTGATTTAATGGATCTCTTAGTTAAACAAAATCAATT
ACTCCCTAATGAAAATAATGATGATTTAGCAAAAATAAGGTTTTGTGTAA
TTGGCAAACCAAATGTTGGTAAAAGCTCACTTATTAATCAACTTGTAAAA
CAAAATCGTGTTTTAGTTTCAAATGAGAGTGGTACAACTAGAGATGCTAT
TGATGTTCCTTTAAAAGTTAATGGTGAAAAATTTCTTTTGATTGATACTG
CTGGTATTAAAAGAAAAGGCAAAATTAACATGGGAATTGAAACCGCATCT
TACATCAAAACAAAGCTAGCTATTGCCCGTAGTAACGTTATCCTTTTGAT
GGTAGATGGATCAAAACCTATTAGTGAACAAGATGAAGTGATTGGTGGAT
TGGCACAAGCTGCACTTATCCCTGTTATTATTCTTGTGAATAAATGGGAT
CTAGTTTTAAAAAACAATAACACCACAAATGCATATAAAAAAATGCTGAA
ATTGCATTTTAAACACCTCGATTTTGCGCCTGTTTTGTTTATTAGTGTTT
TGAAAAATCAGCGCTTAAATACTATTTTTGAACAACTTAAAATTATTCAA
AGCCAACTTGAAACTAAGGTTGCAACACCACTTTTAAATGATGTTATTCA
GCAAGCACAACTTTACAATCAACCTCCACTTTTTAAAGGCAAGCGTTTGC
AGATAACTTACGCAGTACAAACCAAAAGTCAAATTCCCCATTTTGTTTTA
TTTTGCAATGACCCTAAGTATCTTCATTTTTCTTATGCACGTTTTTTAGA
GAATAAGATTAGAGAAAACTTTGGTTTTAATTCTGTACCTATTAGCCTTT
ACTTTAAATCAAAAAACGCACGGATAAGAACAAAGCCAGAAGTTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1347
View in model
Transcription unit TU_232 View in model
Empirical formula (pH 7.5) H14389C13041N5448O9370P1347
Molecular weight (pH 7.5; Da) 439078.80 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
13919300
pI 3.93
 
Comments
Comments ribosome stabilization [PUB_0058]; era/mnmE/trmE subfamily; helps incorporate L16, L27, L36 protein into 50S ribosome [PUB_0223, PUB_0104]; 23S rRNA maturation [PUB_0223];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Borges CL, Parente JA, Pereira M, de Almeida Soares CM. Identification of the GTPase superfamily in Mycoplasma synoviae and Mycoplasma hyopneumoniae. Genet Mol Biol 30, 212-218 (2007). WholeCell: PUB_0058, URL: http://www.scielo.br/scielo.php?script=sci_abstract&pid=S1415-47572007000200007&lng=en&nrm=iso&tlng=en

  3. Britton RA. Role of GTPases in bacterial ribosome assembly. Annu Rev Microbiol 63, 155-76 (2009). WholeCell: PUB_0104, PubMed: 19575570

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Schaefer L, Uicker WC, Wicker-Planquart C, Foucher AE, Jault JM, Britton RA. Multiple GTPases participate in the assembly of the large ribosomal subunit in Bacillus subtilis. J Bacteriol 188, 8252-8 (2006). WholeCell: PUB_0223, PubMed: 16997968

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:27