MG_327 – hydrolase, Putative esterase/lipase 2

Name
WID MG_327 View in model
Name hydrolase, Putative esterase/lipase 2 View in model
Protein product MG_327_MONOMER
Cross references GenBank: AAC71551.1, CMR: MG_327, BioCyc: MG_327, SwissProt: Q49418
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 407371413178 MG_324 MG_326 MG_327 MG_328 MG_515 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 409871 (nt), Length: 807 (nt), Direction: Reverse, G/C content: 29.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGCTAACGAGTAATAAAAATACTCTTTTTAACTCAATATTTGCCTTTAA
ACCTAAAAAAAGAAAAAACGTTTTTATTTTTTTACATGGATTTGGAAGCG
AATATGCCAGTTTTAGTCGTATTTTTAGCTTGTTTAAAAAGAAAAAGTGG
CCTTTCTTTACTTTTAATTTTCCCGGTCATGGAGACAATGAATCAACAGA
TACAGATCAATTAAAACTAAACCACTTTGTTGATTTGGTTTGTGATTTTA
TTGTTCAAAAAAAACTAAATAACGTCATTTTAATAGGTCATAGTATGGGA
GGTGCTGTGGCTGTTTTAGTTAACAAAGTTATACCACTAAAAATTAAGGC
TTTAATATTAGTAGCTCCTATGAATCAAACTTCTTTCTCAGTTAATAAAA
AGCGGATTTTAGATACTTTTTTTAAGCGTAATAACAGCAACCATAAGGAT
TTTGTTGAACATGAAGAAAAACGTAAATCACTTTTGAAAATAGCTATCAA
TGCATTTAAAAAAAGAACTACCTTTAAAACACTTTACAGTGATATGGTTC
AAAACGCTAAATATGGTAATGACTCACTTGAAAGGGCTTATGAAATGATT
GGTAATAAACCTACCTTAGTTATTTTAGGAGCTAATGATATTGTCACGCC
AACCAAAGCTTCTGTAGACTATCTAGCTAATAAAAGTGACAAGATTATTT
TTAAGGTTATTGATGGTGTTGGTCATTCACCACACGACTCAGCGCCTAAA
CTTTTTTTTGATTATGTGCTAGAGTTTCTAGATAATTTAAAGAAACAAAG
GTACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
807
View in model
Transcription unit TU_230 View in model
Empirical formula (pH 7.5) H8601C7793N3204O5638P807
Molecular weight (pH 7.5; Da) 262346.27 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8358600
pI 4.08
 
Comments
Comments lipase/esterase LIP3/bchO family [PUB_0096]; protoporphyrin IX magnesium chelatase (EC 4.99.1.-) bchO homolog [PUB_0109];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Fischer M, Pleiss J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucleic Acids Res 31, 319-21 (2003). WholeCell: PUB_0109, PubMed: 12520012, URL: http://www.led.uni-stuttgart.de/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:27