MG_325 – ribosomal protein L33

Name
WID MG_325 View in model
Name ribosomal protein L33 View in model
Symbol rpmG
Protein product MG_325_MONOMER
Cross references GenBank: AAC71547.1, CMR: MG_325, BioCyc: MG_325, SwissProt: P47567
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 406293411455 MG_0004 MG_324 MG_326 MG_327 MG_328 MG_515 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 408793 (nt), Length: 162 (nt), Direction: Reverse, G/C content: 31.5%, Sequence:
1
51
101
151
ATGGCTGTTAAAAGAAGCACACGACTAGGTTGTAATGAATGTTCTGAGAT
TAATTATTTAACCTTTAAAAACGTCAAGAAAAATCCAGAAAAACTAGCAC
TTAATAAGTTTTGTTCACGTTGTCGTAAGGTAGTATTGCACAAAGAGGTA
AAACGTAAATAA
50
100
150
162
View in model
Transcription unit TU_228 View in model
Empirical formula (pH 7.5) H1737C1574N672O1116P162
Molecular weight (pH 7.5; Da) 52941.15 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
3.83706 (dimensionless) (Show evidence)
View in model
Half life
3.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
1684400
pI 3.73
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:27