MG_322 – potassium uptake protein

Name
WID MG_322 View in model
Name potassium uptake protein View in model
Symbol trkH
Protein product MG_322_MONOMER
Cross references GenBank: AAC71544.1, CMR: MG_322, BioCyc: MG_322, SwissProt: P47564
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 401223407900 MG_321 MG_322 MG_323 MG_515 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 403723 (nt), Length: 1677 (nt), Direction: Reverse, G/C content: 33.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
ATGGTAAAACTCACCACTTGGTTAAAAAAAATTGGCTGAGGTGAGACTAT
TACCCAACGAATTTTTTGTTTTTATATCTATTGCATCTTGTTTGGAAGTT
TGCTGTTATTTTTGCCAATTGCACTCCAAGATAACTACCAAAAAGTGGTT
AGTTATGGAATTGATTGACAGGGAAAAAGATTTGAACAGAAAACTGATTA
CAACTTTTTAGATGCATTATTTTTATCAACCAGTGCTTTTAGTGATACAG
GACTTTCTACTGTTGTTGTATCAAAAACATACAGTATCTTTGGCCAGATA
GTTTTAGCAGTATTACTCCAGTTAGGAGGGATTGGATTTGTTGTTATTGC
TTTTTTAGCATGACGATTGTTTAACTTTCACAAGAAGGAACAATACAGTT
TTTATGAAAAGTTAATGTTGCAATCAGAACGAGGTGGTTCTAAGCTAGGT
AATACTAGTGAGATGATCTTAGTATCTATCATCTTTCTTTTTATCGTTGA
ACTAATTTATGGATTTTTATATGGTATTTTGTTTTATTTCATCCCAGGCT
TTGAACCTGCTAACTTGTTTGCAGATCATGCAAAAGTTTCAACTCAATTA
AAAGCTTTAGTAGTTGATTCAAACCAAACAATAGCAGCTTTTAATGATAT
TAATAAGGCTTTTCAAGCAGGTTTTTTCCATTCCTTATCAGCAGTTAATA
ATGCTGGGATAGATCTGATAGGGGGTAGTTCTTTTGTTCCTTATAGAAAT
GGACTTGGTATTATTATTCAGTGGTTAACTATTAGCCAAATTATCTTTGG
GGGAATTGGTTATCCTTGTTTGTTTGATGGCTTTGAAGCCATTAAAAAAA
AGATTAAGTATGGTAGACACACAAAACACCAATTTAGTCTATTTACCAAG
TTGACAGTAATTACTAATATCGTTGTAATCCTGCTTTTTTTCACCTTACT
TTTAATGGTGGAATTTATTGCTAGTGATAGTTTAACTAACACTATTGTTA
ATTTTAGTGATGAAAAAAAGAGTTTAATAAATACCCAATTGCAATCACAA
TCTAACCAAGCAATCCATGCGTCAGTTTTTGGTAATAACCCTAATGCAAG
TAGGGTAATGCAGCTCTTTTTTATGGTTATTTCATCCCGTTCAGCAGGTT
TTAGTGTTTTCCCTGTTGCTAGTGAGATTCAAACTACAAAAATAATTATT
GCATTGGCAATGTTTATTGGTGCTAGTCCCTCTTCTACTGCTGGGGGGAT
TAGAACAACTACGCTAGCAGTAATCTTTTTAGCTCTAGTTGCTAAGTTTA
AAGGTCAAAAGGAAGTAAAAGCATTTAAGCGTTCAATCGATCAAACTACA
GTAATAGATGCTTTTTTAGTACTAATCATAAGCTTAATTGCAGTTTTACT
AACAGCTGTTCTTCTACCTTTAAGTATGGAACAACCAGTTAGTTTCATTG
ATGCTTTATTTGAAACAACTAGTGCTTTTGGAACAGTTGGACTTTCAAGT
GGAGCTACTGTTAACATTGCTTTAGATCCAAATAGAAATACCTTTAATTT
CCTTGCTTTATGTCTATTAATGGTTATGGGACAGGTTGGTGTGTCCAGTT
CTGTGCTAACTTTTGTTAGAAAACATCCCAAAGCAAATAGTTATTCATAT
CCTAAGGAAGCTGTTAAAATTGGCTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1677
View in model
Transcription unit TU_224 View in model
Empirical formula (pH 7.5) H17830C16152N6531O11853P1677
Molecular weight (pH 7.5; Da) 545029.39 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
0.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
17144300
pI 4.46
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:26