MG_320 – membrane protein, putative

Name
WID MG_320 View in model
Name membrane protein, putative View in model
Protein product MG_320_MONOMER
Cross references GenBank: AAC71542.1, CMR: MG_320, BioCyc: MG_320, SwissProt: P47562
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 396438402299 MG_317 MG_318 MG_319 MG_320 MG_321 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 398938 (nt), Length: 861 (nt), Direction: Reverse, G/C content: 32.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGATTAATTCAACAAAAGGCTATATTGATCAAAACGGTTTAGCAGCAAA
GCAGTTTGTACAAACAAAACAGCTTTCTGTAATCCGTTTAACTTTTATGG
TAGCTGCTTTTGGGATCTTTTTTATCTTTCTTGTTGCATTAACAGTACAA
CAATTGCTTTCAAGAAGCACACTAATTGATTTAGCTAGTGATTTTAGAAC
ACTTAGTACTATTGCAGTTATTACTAGTTTTGTCTCTTTAATTCTTTATT
TTGTTACTGCTTTTAAATTAAGGAATCCCAACACTAGTTTGACATGGTTT
TGGGCCTTAATCATTACTGATGTGATTAGTTATGGGATAACCCTTGGGAT
CTTATTAACTTTAGCAACGACATTTTCAAAACAAGTTAACTTTGAAGCTA
ATGACATTGTTTATGCTTTTTTAGGTGCTAGTTTGGTGTTTGGTTCAGTG
TGAGGATTAAGTGCGCTACCAAGTCAAAAAAGGCGATATCAACAAACCCA
AACTTTGTTTCACATCTTATTATGGGCTTTTGTAATTAGTATTGTAGCGA
GCTTATTGAGCTTTATTTTGAACTTTACAGTGTTTGCTTCTACAACAAAC
CTACTTGATAGAATTATCCCTGGCTTATCTTTAATAGTAGGGGGAATCTT
TTCATTAATTTCAGTTTATTTTGTGAGTTTACAGATCCGTAATGAACAAG
ATTTGATTAAATACTATGAAAGTGAAGATTATGAAATGGCAAGAAGACAG
AGCTGAAGATCTGCTTTATTCTTTGGGGCTTGATTAATTAGCAGCTTCAT
GAATTTGGTCTATTTCATCCTAAGAATCATCCTAATTACTAAAAATTTTT
CTAGAGTTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
861
View in model
Transcription unit TU_219 View in model
Empirical formula (pH 7.5) H9143C8281N3318O6102P861
Molecular weight (pH 7.5; Da) 279446.85 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8774100
pI 4.61
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:26