MG_318 – P32 adhesin

Name
WID MG_318 View in model
Name P32 adhesin View in model
Symbol p32
Synonyms p30
Protein product MG_318_MONOMER
Cross references GenBank: AAC71540.1, CMR: MG_318, BioCyc: MG_318, SwissProt: Q49417
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 394939400782 MG_316 MG_317 MG_318 MG_319 MG_320 MG_321 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 397439 (nt), Length: 843 (nt), Direction: Reverse, G/C content: 39.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGGAGTTAAATGGATTTTTGAGATACAAAAAACTTTTTATAGTTCTTGC
TTTACTTTTTACAACAATCCTAATTGTTAGTTTATCGTTACTAGCATTTG
CACTTGTTGTGAAAACTAATGGTAGTGAACTAGGGGTTGTTTTTCATCAA
ACAGAAGATAATACAACTGTAATTCAGGGCAGATCAATTGTTGAACAGCC
CTGATTTATCCCTACAGTAGCAGGTTCATTTGGTTTTAGTGCTTTAGCTA
TTATCCTTGGACTTGCGATAGGTTTACCTATTGTAAAGCGCAAAGAAAAA
CGTTTACTTGAAGAGAAGGAACGCCAAGAACAGATTGCTGAGCAATTACA
AAGAATCTCAGATCAACAAGAACAACAAACAGTTGAAATTGATCCTCAAC
AATCCCAAGCTCAGCCTTCCCAACCCCAAGTTCAACAACCCCTTCAACCA
CAGTTTCAACAGCGTGTTCCGCTTTTAAGACCTGCATTTAATCCAAACAT
GCAACAACGCCCTGGTTTTAACCAACCAAACCAACAGTTCCAACCACACA
ATAATTTCAACCCAAGGATGAACCCAAACATGCAGCGCCCTGGGTTTAAT
CCAAACATGCAACAACGCCCTGGTTTTAACCAACCAAACCAACAGTTCCA
ACCACACAATAATTTCAACCCAAGGATGAACCCAAACATGCAACGCCCTG
GATTTAACCAACCCCATCCTAACCAATTTGCACAACCAAATAACTTTAAT
CCAAACATGCAACAACGCCCTGGGTTTAATCCAAATATGCAACAACGTCC
TAACCCATCACAATTGATGCCAAAAGGCGGTTTAAAACCCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
843
View in model
Transcription unit TU_217 View in model
Empirical formula (pH 7.5) H9058C8214N3567O5824P843
Molecular weight (pH 7.5; Da) 277038.77 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8427000
pI 3.65
 
Comments
Comments clustered at tip organelle [PUB_0088]; no cysteines, therefore very flexible [PUB_0088]; high proline content may assist in topological organization [PUB_0088]; appears to be directly involved in adhesion [PUB_0405];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Krause DC. Mycoplasma pneumoniae cytadherence: unravelling the tie that binds. Mol Microbiol 20, 247-53 (1996). WholeCell: PUB_0405, PubMed: 8733224

  4. Razin S, Jacobs E. Mycoplasma adhesion. J Gen Microbiol 138, 407-22 (1992). WholeCell: PUB_0088, PubMed: 1593256

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:26