MG_316 – DNA internalization-related competence protein ComEC/Rec2

Name
WID MG_316 View in model
Name DNA internalization-related competence protein ComEC/Rec2 View in model
Symbol comEC
Protein product MG_316_MONOMER
Cross references GenBank: AAC71538.1, CMR: MG_316, BioCyc: MG_316, SwissProt: P47558
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 391975398085 MG_314 MG_315 MG_316 MG_317 MG_318 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 394475 (nt), Length: 1110 (nt), Direction: Reverse, G/C content: 27.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
ATGCAAACAAAGCTGTTTTATTTTTTTGTTTTACTCAGTTTTATCCCAGG
CTTCTTTTTAGTACAACAAGAACAGTTTGTTGCACTGTCAATTTGGATCA
TTTTGATAACGCTTTTTAGTCTTTGGTATGACTGAAAGTTTTGTTTATTG
AACTTAACAATTGTTGGTTTTTTTATTGCTTTTTGTTATTTTGTTCCAGC
AGTCAAGATAAATCAAATTGTTAAAAATAACTTTATTCGTACCCCTTTCA
TTAATTGAATTGATCAGACCACTAAAGGTGAGTTAAATCAGTATTTAAAA
CTATTTTTAATTAATGAAACCACTAAAAACAATTTGTACCAAAATGCTTT
AAAACTAAACATTGTCCATTTGTTTGTTATCAGTGGTTTTCACTTAAGTT
TCTTGTTTAATTTAATGGAACGGTTTTTATGAAAAAGATGGTACTTAAAC
AAACTTAGTGGTTTTGCTGTTTTATTGATTTACCTGTTTTTAGTAGGATT
TGCCTTTTCAGCACTAAGAGTTTTTATCTCAACACTGTTAAAACAGGTTT
TTAAAAAACAGTTACCAGAAGATAACTTAAGTTTAACTGCACTTTTAATC
ATTCTTATTAGTAACCATGCTTTAAATAACTTTGGTTTTAATTTTTCTTT
TCTAGCTTGTTTTGTATTGTTATTTGTCAACAAACTAAAGTTATTAAAAG
CTTTAAAACCGCTTGTCAGTTCTAGTTTAATCTTGATTGTTATCAGCCCC
TTAAGCTTGTATTTAAATTCAAGACTAAATGCTTTTAGTGTCTTGTTTAA
CCTTTTGTTTAGCCCAATTGCCTTATTTTATTTTTGTGTTAGTTGAATTA
TTTTACCCTTTATTGGTGTTTTTGGTCAAGCTAGTTTTGGTATTTATCTC
CCACTTAAAATGCTAAGTGAATGATCATTAAAAGTAACAGTTTTTCTACA
AATACCTAAACCTAATCTGATTTTCTTTTTTGTTTATTATGGCTTATTGG
GACTTTTATATACTATTTTTACAGTAGCTTATTATGACAATAATTTATGG
TCAAGATATTGGGCTAATTCACCAAAAATTAAGTCAAATCAAAAGCAATT
CTCCATATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1110
View in model
Transcription unit TU_216 View in model
Empirical formula (pH 7.5) H11735C10624N4122O7918P1110
Molecular weight (pH 7.5; Da) 358229.17 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
11323000
pI 5.63
 
Comments
Comments may transport DNA across cell membrane [PUB_0110]; one strand is transported through comEC channel, second stand is degraded [PUB_0412]; comE has non-sequence specific DNA binding activity in N. gonorrhoeae [PUB_0177]; necessary for competence in N. gornorrhoaea [PUB_0177]; necessary for DNA uptake in B. subtilis [PUB_0178]; may be an aqueous DNA channel [PUB_0178]; however other competence proteins (comFA, ATPase; comEA, DNA binding protein) are absent in M. genitalium;
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen I, Dubnau D. DNA uptake during bacterial transformation. Nat Rev Microbiol 2, 241-9 (2004). WholeCell: PUB_0412, PubMed: 15083159

  3. Chen I, Gotschlich EC. ComE, a competence protein from Neisseria gonorrhoeae with DNA-binding activity. J Bacteriol 183, 3160-8 (2001). WholeCell: PUB_0177, PubMed: 11325945

  4. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 2 more

  7. Inamine GS, Dubnau D. ComEA, a Bacillus subtilis integral membrane protein required for genetic transformation, is needed for both DNA binding and transport. J Bacteriol 177, 3045-51 (1995). WholeCell: PUB_0178, PubMed: 7768800

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:26