MG_313 – membrane protein, putative

Name
WID MG_313 View in model
Name membrane protein, putative View in model
Protein product MG_313_MONOMER
Cross references GenBank: AAC71535.1, BioCyc: MG_313, CMR: MG_313, SwissProt: Q49414
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 388895394759 MG_312 MG_313 MG_314 MG_315 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 391395 (nt), Length: 864 (nt), Direction: Reverse, G/C content: 29.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
TTGTTTCCTTACTATCCGTTGAGACTTTTAAAGAGTTTACAACTGTTAGT
TTGAGCTAGTGTTTTATTAGCACTAACCTTTATCTTTTCTATCTTTTCAA
TTAGTGTTACTAATGTATTAAGCATTAGTTTTCTAAGGATTCCCTTTGCA
TTGTTCGGATGGATCTTTGGTCCTATTTGGGGTTTTATTTTTGGATTTTT
ATCTGATACTATTGATTGGTTAACAAAGGGTTATGTGTGGTTTTGGATGT
TTGCATTGCAAAAGCCACTCTTTGCTTTTCTTGCTGGCATAGTTAAAGGG
ATTTATCTAGTTAGAAAAAATGCCAGTAATTACAAGGTTGATTTTTGGGT
GTTACAAACACTATTAGTAACTTTTTTTGTTGTTAGTGTAACACTGCTTT
TACTTTATCTAACTAATAATGAGTTTCAGCAAATTGGAACAAAAAATTTT
CAAACTGCTGATCTTAGTGTTAATGTTGTTGTTTTACAAATCATAACTTT
AGTTAGCTTTGTTATTTTCTTTTTAGTAACAGAAGGATTTTTAGGGTTTG
TTTATGTAAAAAAGAGAAATAAAGAACAAGCACTTTTAACTATTTATAGC
TTGGTTCTAATGGTTTTAATGTCAGTAGTTGTTTCTATCCTTTTGGGGAC
AATTGCTGCCATTGAGTTTATTACTTTTATTAATAATGGCAGACCAAGTA
ATAACTTTGTTTTGTATGGGGTTTATTTCTTTCTTTTACCAAGAGTATTG
GTGCAAGCGTTATTATTACCTATCTATGTAGCTTTGTTTTACCCTTTAAT
AGGGATTGTGGAAAATAATTTAAAAAATTATTTATTACTATTTACGCTTT
CATGGAAGAGTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
864
View in model
Transcription unit TU_215 View in model
Empirical formula (pH 7.5) H9131C8266N3198O6190P864
Molecular weight (pH 7.5; Da) 279074.66 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8828700
pI 8.38
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:25