MG_310 – hydrolase, Putative esterase/lipase 1

Name
WID MG_310 View in model
Name hydrolase, Putative esterase/lipase 1 View in model
Protein product MG_310_MONOMER
Cross references GenBank: AAC71532.1, CMR: MG_310, BioCyc: MG_310, SwissProt: Q49412
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 383963389770 MG_309 MG_310 MG_311 MG_312 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 386463 (nt), Length: 807 (nt), Direction: Forward, G/C content: 31.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGCGACTTGAAATAGAAAACGGGCTTGAATTTGTCAATGATCCTGTGGT
AAATGAACTTGGCAAGATCTGTTTTTTTCATCCTTTTACAGGTAATTTAA
CAAACAAACTTAGTTTCAGAAGTCATTTCAATAGATACAGTTTTTATGCC
ATTAACTACCCAGGGCATGGTAATAGTGTTATTAACAATCCAAAGCAACT
TGAATTTAGTTACTGATTGGAAATTACAAAACAGTTTTTTGATAAACATA
ACTTAAAGGATGTAATCTTATTTGGTCATTCTATTGGCGGTGGTTTAGCA
GTTGCTTTAACTAACTATTTAAGCAGTGATCAATATAAAGCAGTCTTGTT
AGAAGCACCATTAAATCCTGCTATTGTTGAAACTCCTTTAAATATTGTTC
AAAATCTCATTCCTGATCCTGATAGTGATTTTGCTGTTATTCAAAAGTGT
CTTGTTTACAATATTGAGAAAAAACTTGGGGCAAACTTTAAAGAATATTG
TGAAAGAGAAAAGCAAAAATCAATTCACCAAAACCAACGCCTTAAAGTGA
TGTTAGAACCTTCTACACTCAAACAAAACATAGTTTTAATCAATGCAGCT
TTTTTAAAGTTAAATTGTCCTGCTTTGTGAATCCATGGTAAGCAGGATGG
AATTATTAAGTACCTTCCATCCAAGGCTTATTATGAATCATTAAACAATA
AGCAAATTCAATTTAAAGCCATAGAAGCAGCGGCTCATACCCCTTACTTT
GAACAACCACAAAAGTTTTTAAGTTTAGTTAATGATTTCTTTCAATTAAT
AAGTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
807
View in model
Transcription unit TU_212 View in model
Empirical formula (pH 7.5) H8607C7799N3222O5638P807
Molecular weight (pH 7.5; Da) 262676.51 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8295600
pI 4.03
 
Comments
Comments lipase/esterase LIP3/bchO family [PUB_0096];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:24
Last updated 2012-10-01 15:13:25