MG_309 – lipoprotein, putative

Name
WID MG_309 View in model
Name lipoprotein, putative View in model
Protein product MG_309_MONOMER
Cross references GenBank: AAC71531.1, CMR: MG_309, BioCyc: MG_309, SwissProt: P47551
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 380232388910 MG_307 MG_308 MG_309 MG_310 MG_311 MG_312 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 382732 (nt), Length: 3678 (nt), Direction: Reverse, G/C content: 30.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
2201
2251
2301
2351
2401
2451
2501
2551
2601
2651
2701
2751
2801
2851
2901
2951
3001
3051
3101
3151
3201
3251
3301
3351
3401
3451
3501
3551
3601
3651
ATGAAACGTTTTTTACACCGAGTAAAATGACCATTGCTGCTTTCAAGCAT
AGCTGTAAGTTTGGGAATTGTTGCTGTTGCCTGTGCACAACCAAACTCCA
GAACCATTGAAAATCTCTTTAGACCCAGTAGTGCTTTTACTGATAAAAAT
GATGGTAGTATTAATGCCACACTTTATAAAGCACTTGAAAATAGAGAAGG
ACTAACGCAATATTTAACGATGCGCCTAGCGCCAGTATTGCGCAATTTTT
ATGAAGAAAATGTTGATGATGACATTAAGAGAAATTTAAGAACTTTTAAT
ACTGATACAGACAATAGTTTTGTTAATCAAGAACAAAACTTAAGAAATCA
GTATCGGGGTGATTATTTAGTTAGGTTACAAACTGATATTTTAGATAACA
CTGGTGGAAATCAAGCCAACTGAAAGCTCCGTGATGTTAACAACAAAATT
GTTGATGATTTTATCAATAAGCTTTTTACAAAGAACTTTGTTGAATATGT
TGATAAAAGTGTTGGCGTATTATCAACTCCATTAAAAGGTTTAATTGAAA
ACCAAAGTAATTGGAATAATATCAAAATACAAGCTAAGTTTGTTGATAAA
AATAAAAGACTTAGGATCAATAATGATGCAGTTTATGCTGCCATTCAAGA
TAAATTATTAGATCAGTTCGTTACTAATGAAAACCCTAACTTAGTTTCAA
GAGTAGTATTTACTAATGAAACTCCTAATGATGGGTTTGATAACTATTTT
AATCCTGATCTAATTAAATCTCCAACCCCTTCCTATCAATTTCAAGTATT
TAACAAATATAACCAACAAGATAACTCCATAAAAGGAGCAAATGGTTTTC
ATATCCTAGCTAGTAATTTACAAAGCTATGTAAATACTAACAATAAAACC
ATTGACATCCCTAATAAGTTTTCTAGTGATAGTGGTGGTAAATTGTTGTT
AAAAGCTAGTGATATGTTTGATACCTTTGATCCTAGCTTTTCAGCAGCTT
TTATCCAGGGCTATTTAGCTTTACAAAAAAAATCCAAAGGTGCAGAACAA
ACTGAATACACTAAATTAGAAAAAGATAAATCAATCATTGAAAATTTCTT
TGTTGAAAATAATTCAGCTAAGGCTGCAATGAAAAGTGCAAGTAGTAGTT
CACAAACAACTACTGTTCATAAAACAGATCTAGCTAAGATCTTTAAAGAA
AATGAAACTACTAAATCAACAGATGTTTTTAAAGGTGAATATCAAAAAAA
GTTCAGTAATGCTACTAGTACAAGTAACAGTGATAGTAGTAATAATTCTG
CAATCGTTGATCTAAAAGAACTTAAAAAAGATAACAATAGTCAACCTGAT
TTAATCTTAGCACGTGGTAAAGATGGTATCCATCTAATGGGTGTTGATGG
TGGTGGTTATTATCTCTCTGAATCAGGACGTGATGTAAATAAACAAAAAC
AATTCTTATTATTCCGTGCACTACAAACCAAATATGGCTTAATTGATACA
AACACTACTTATGACTTTAAGTTGTTTGATGAAGTGAAAAAACACTTTGA
TAAGAACAGAGTTTTATTTTTATTTAATGCCCTTTTTAAATTAGTAGACA
GCAAAGAAAGTAACTTTTTAAGTTTCCCTCAGTTTAAAAAGTTTAGTGAT
AGCATTATCACTGTTAAAAACGAGTTGAAGGATTTAGTTGAAAGTCAATA
TCAACAAATTGTTTTTAATGAAGTTGCTACTGCAGAAAACAAAGTTGCTT
TAAAACTAGCAGAACGTAACCAACCTTTCATTGATAATGAGCGAAATAAA
CAAATATGGATGAACGGTTTAGCTGCTGTTTTACCTTATGAACAAGATAG
TAAAACAGGACACTACAATGAACTTGGTATTTACTATAAAGACATCATTG
ATAAAGTTAGTTCAAATACAAGTAATAGTAATAGTAATAGTAATAGTAGT
AGTAGTGATCCTTTTTCAAAAAAGATAATTGACAAGTTAAAAGAGAATAA
AAAGAAAGTTGAAGCAGCAGTTAAAAAGCATGTTGATGAACTAAAAGTTT
CGGTAATTCCCTCACCGCAATATTCACAAATTATCCTTGTTGATACCAAA
CTTTCATCTGATCCTAGAAACACTTCTCTAGCACTTAATTTAGCTTTAAA
TGCTGTTTTATCAAGTGATGAGTTACAAAATACCATTAGACGAGATTATT
TTGTCAATGATGATCAGTTTAAACAAGCGATTGATTTAGATAAATTAACT
TTTAAAAACTGAAACAGTCTCAATAATGAAAACTGAAATATCTTTAAATA
TACCTACCTATTTGATCTTTTTCAAAAACAAGCTAATCCTTCTATTTTTG
GTAATGGTGTTAATGAAAGTTCAACTGATAATAAACCCAAAATTAATGGG
GTTTTAGATAGTTTATACAACAGCTTAAACTTAGAAGAACGCTTGGATAG
CAATGACTTAATCAATTACTATTCTTATCTTTATACAGTTCAATGGCTAT
TAAAAGATAACCTTAAAAACCTAAAACAGAACTTGCAAGCTAAACTATCA
AGAACAACAAATAGTTTCTTGGTTTGAAGTTTAGCTAGTGATAAAGACAG
AAATAATACTGCTAGTCAAGCAATGAGTGTAAGTTCTTCTAAATCTGTAT
TAGTAAAAATGGCTAACAACGTTGCTTCTCAAACTAATCAAGACTTTACC
AAGCAAGAACAACAAAATCCTAACTATGTATTTGGTTCGAGTGCTTATAA
TTGAACCAACAACAAAACCCCAACAGTTAACAGTGCTGCAAATGATATTT
CAAGTCTTTACTATACAAAGAACAATGGTAGTAGCAGTACATCATTAACT
TTAATGCAAAAAAGTGCACAGCAAACCAATAACCAGCAAAGAAGGTTTGG
TTTCCATGGTATTGTTACCAACACTTCATCCAACAACTTACCAGATGCAG
TTAGAAATCGCCTCTTTACAAGTTTTGTTTCCCAATCTGAAAAATCAAGT
TCTAATGGTGGTCAAGCACAATTACAATCTACTCAATCAAGTGGTAGTAA
TGAAACAATTTACAAAGGTGCTTTATTTAGTTTTGGTTCTCTAACAAAAC
TTATAGAAACAATTGATAACATCCCAACCCAAGCTGAGTTTGATGCACTT
TATAACCATTTAACAAGTAACCTTAATATTAACGTTACTGGTGTTGATAG
ATCAAAATCCTTACAAGAACAAAAAACTAATTTGAAGAATTTTGCTAATT
CAAACTTTAACAATACTCAAACTGTTCAATTAAAACAAGCTCAAAGTAAA
ACTAATAATAGTAACTTTAATGATGTGTTTAGTAGGTTTGAAGGGTATAT
AGGTACAAATAAAACCAGTAATTATAGCAGTTATAACTTTTTACAAGATA
ACCAGATCTATCATGCAGTTTATGCAAAACAGATTAACCTTGAAGATGTA
AGTATGCTTGGTAGTGATAGTTTGAATAGTACAGATTCAAATAATTCAAA
AAGACTTGATCTTTCACTTGAAGAATTTTTAAGTACAGTTGCGCTTGAAG
CGCTTAATCCTAATAATCAAACCCAAGCTATTAATGCATTGATAGCAAAT
GCCAAAAATGGCTTAGTTAGAGTTGGTGATAACAGATTGTTTTCAGCAAT
CAGTTCACAGTGAGTGCGTAAATTCTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2150
2200
2250
2300
2350
2400
2450
2500
2550
2600
2650
2700
2750
2800
2850
2900
2950
3000
3050
3100
3150
3200
3250
3300
3350
3400
3450
3500
3550
3600
3650
3678
View in model
Transcription unit TU_211 View in model
Empirical formula (pH 7.5) H39314C35635N14955O25484P3678
Molecular weight (pH 7.5; Da) 1198746.42 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
38371600
pI 3.85
 
Comments
Comments activates NF-{kappa}B via TLR2/6 [PUB_0194];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. McGowin CL, Ma L, Martin DH, Pyles RB. Mycoplasma genitalium-encoded MG309 activates NF-kappaB via Toll-like receptors 2 and 6 to elicit proinflammatory cytokine secretion from human genital epithelial cells. Infect Immun 77, 1175-81 (2009). WholeCell: PUB_0194, PubMed: 19103762

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:23
Last updated 2012-10-01 15:13:25