MG_298 – chromosome segregation protein SMC

Name
WID MG_298 View in model
Name chromosome segregation protein SMC View in model
Symbol smc
Protein product MG_298_MONOMER
Cross references GenBank: AAC71520.1, CMR: MG_298, BioCyc: MG_298, SwissProt: P47540
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 363082371031 MG_295 MG_297 MG_298 MG_299 MG_300 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 365582 (nt), Length: 2949 (nt), Direction: Reverse, G/C content: 32.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
2201
2251
2301
2351
2401
2451
2501
2551
2601
2651
2701
2751
2801
2851
2901
ATGGTTTTTCTAAAACGTTTTCGCGCATATGGTTTTAAATCATATGCTGA
TGAAATCACAATTGATTTTACCCATTCAATGACTGGTATTGTTGGTCCTA
ATGGATCGGGCAAATCCAATGTTGTTGATGCATTAAAGTGGGTTTTAGGG
GAGAGAAGTATGAAACATCTCCGTAGTAAATCAGGTGATGATATGATCTT
TTTTGGCTCTAAAGACAAACCTGCTAGTAAGTTAGCTGAAATAGAGCTAA
CCTTTGATAATTCCAACCGTTTATTACATGATTCAAGAAAAGAGATAAGC
GTGATGCGTAGGGTTTATAGAGGGAGTGGCCAGAGTGAATATTTTATTAA
CTCCAATCCAGCAACTTTAAAAGAAATTAGCGGTATTTTTGCTGATATTG
GTCTTGAAAAAGGTTCACTTGGAATTATTTCACAAGGGAGTGTCTCTTGA
TTTGTAGAAGCTAAGCCAGAAGAACGCAGAAAGATCTTTGAAGATGCGTC
GGGAATTGGTAGATATACCAAGCGTAAAGAAGAAGTTGTTAACCAGTTAA
ATCGAACCTTAATTAACTTAAAACAAGTTAGCGTTGTTTTAAATGAACTG
AAAAAAGATTTAAAAAAGCTTACATTACAAGCTGAAAAAGCACAACAATT
CATTAGGGTTAAAAACGAATTGAAAGAGTTGGAACTTGCTGTTTTGGTTG
GGGAATATCTCCAAGCACAAACTGAACTTGATAAGTTTAATTTTCAGATT
AACAGTAGTGAACATGACTTTAAAATACACGAACCCCAACTAGAGTTGTT
AGAAGAACAGATTGTTATCTTTAATAGTCGCTTTCATAGTGCTGATATGC
AATCTAATGAATTGCAAAAAGAGTTACAAGATATTTACCAAAAGATCAAT
GAATTGGAACAACGTAAAGTCATTATTGATGTGCAGTTAAGACAAGGTTT
TTCACAAAAAGATGAAAAGCAAAAAGCTGCAGCTTTAAAAAAACTAATTT
TAGTTGATCAAACCCAGCTTGATGGTTTTGAAAACCAACTATCAAATTCC
AAAACAACCATCACTGATCTTGAAAAACTAATTAACGAACAAAAATCACT
TGTTGATCAGATAAAGTTACAGATTGAAAAAAATACTGCTGATTTAATTT
ACCAACGTTCCTTAAAAACAATTATTGAACTCCAAACTAATGAGCTTAAA
AAAACTAACAATGCCAATATCTTAGTTAAAAATGCTAATGCTTTAACAGG
AATTTTAAATACACTAGGAACATTTCTTAAATTTGATAAGCAGTATGAAA
AAGCTATCTTAAAAGCACTTGGAAAATCAATTGGTTACCTAGTTGTTAAC
AACAATAATGCTGCCATCCAAGCAATAGATTTTTTAGTCAAAAATGAGAT
AGGTAAAGTAACTTTTTTACCTTTAGATGATGTTGCTAGTGATACTAAAA
TCACAAACGAACACATGGAAATTTTAAAGCAGCTTGATGGTTTTCTTGGT
GTTTGTAGTGATCATGTTAAGTGTGATCCATTGTTTCAACCAGTTGTAAA
TACTCTTTTAGCACAAGTTATTATTGCTAAAGATTTAAATAGTGCCATTA
ACCTTTCTAACTATACTTACAAGTTATATAGGATCGTTACTTTAGATGGT
GAGACAGTTTATGCAGGGGGAATTATCAATGGTGGATTTGAAAAAACAAA
TCTTAGTGATGGGTATTTATCATCAGCTTCACTTGATAATGAACAGAACA
TTAACAAACTAGAAAACAACGAACGAGAGTTAAAAAAGGAGCTTACAGAA
CTAGAAGTAAAGCTAGATGAAATGAACAGAAAACTCAAGTATGAAGAGTT
GTTACAAGCCAAGTTTATAGAGCGTATTGTTCAAATTAAAAAAATTATTT
TAGAGCTCAAAATGGAATATGAACAACTTACTAACACAACTTTTGATGGT
AAAAAAGCTGTTGCTAGTGAAGCTGAATTAATCCATTCATTAAATAGTGC
TTGAGCTAAACGTGATGAAATTAACTCTAAGTTAAAGCTTAATCAAGAAC
TTAAGTTACAACTAGCAAAAACAATTAAACAAAGTGAAGAGAAGATAGTT
GATCTTAGGGCATTGTTAGATGAACAACGTGCTAAATTAGTTTCAGCGCG
GGAAGGAAAAATTAGGTTTGAAAATACAATCCAAAATATCACTGAAAAGA
TTAACAGTGTTTACAAAATGACAATGGAGTTTGCTATTGCTAATCACAAC
AAACCAGTTAAACTCTCTTCTATGCAAGCCCATAACAAGATTGCTAAACT
ACAAAATCAATTGAATGAAATGGGGGTAATTAACATGGAATCAATTGCTG
AGATAAGTGAAAAGCAAAAGCGCTTTGATGATATTAACGCTGAATATGAA
TCAGCTCAACAAGCAGTTGAAAATTTGCAAAAAGCTATTACTGAAATTGA
TGAAATTGCTAGCAATGAGTTTGATCAACTGATCCAAAAATTAAATCAAG
AGTTGCCAAAAACTTTCAAATATCTATTTGGTGGTGGTTCTTGCCAAATT
CGTTACACTGATCCTAGTAATGTATTGGTTTCAGGGATAGATGTCTTTGC
AAATCCTCCTGGTAAAAATATTGCCAACTTAATGTTGTTATCAGGCGGGG
AAAAAACTTTAGTTGCACTTTCTGTTTTATTTAGTATTTTGAAAGTAAGT
GCTTTTCCACTTGTTATTTTAGATGAAGCGGAAAGTGCACTTGATCCTGC
TAATGTGGAGCGCTTTGCTAACATCATTAAAACTGCTAGCAAAAACACCC
AATTTTTAATTATTACCCATCGTCAAGGTACAATGATGAAATGTGACATG
TTATTGGGTGCTGCAATGCAAACTAAAGGTGTAACTAAAACCTTTGCAGT
TGAACTTGAAAATGCTGAAAAATATGTATCTGAAAATGATTCTAATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2150
2200
2250
2300
2350
2400
2450
2500
2550
2600
2650
2700
2750
2800
2850
2900
2949
View in model
Transcription unit TU_202 View in model
Empirical formula (pH 7.5) H31549C28599N12072O20432P2949
Molecular weight (pH 7.5; Da) 962622.61 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
30702600
pI 3.85
 
Comments
Comments in B. subtilis forms a complex with scpB and smc (scpA:scpB:smc::1:2:2) [PUB_0337];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Mascarenhas J, Volkov AV, Rinn C, Schiener J, Guckenberger R, Graumann PL. Dynamic assembly, localization and proteolysis of the Bacillus subtilis SMC complex. BMC Cell Biol 6, 28 (2005). WholeCell: PUB_0337, PubMed: 15987505

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:23
Last updated 2012-10-01 15:13:23