MG_297 – signal recognition particle receptor

Name
WID MG_297 View in model
Name signal recognition particle receptor View in model
Symbol ftsY
Protein product MG_297_MONOMER
Cross references GenBank: AAC71519.1, CMR: MG_297, BioCyc: MG_297, SwissProt: P47539
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 362035368076 MG_294 MG_295 MG_296 MG_297 MG_298 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 364535 (nt), Length: 1041 (nt), Direction: Reverse, G/C content: 30.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
ATGGGCTTTTTAAGCAAGTTAATTGCCAAACTAAAACCAAAAAAATCAGT
TGCTAAACAGCTTAAAGAAGAAGTTGAAAAACAAAGCCTTTTTCAAACCA
ATAATAAAACTTACTATCAGGGTTTGAAAAAATCTGCTACAACTTTCGCT
AAAACTATTAATGAACTGTCAAAACGATATGTTAATGTTGACGAACAGTT
TAAAGAAAATCTATTTGAAGGGCTAGTTTTGCTTGATGTTGGTTATCATG
CTGCAAACAAAATTTGTGATGCTATTATTGAACAGATCAAGCTAAACAGA
ATTACAGATTTTCAGCTCATTAAAGAGCTAATTATTGACCAAATTATTGT
TTATTACATCCAAGATAAACTCTTTGATACTGATTTAATAGTTAAACCTA
ACTTTACAAATGTTTATCTCTTTGTTGGTGTTAATGGAGTTGGTAAAACA
ACTACTTTAGCTAAGATAGCGGATTTTTTCATAAAACAAAATAAACGTGT
TCTACTTGTTGCAGGTGATACTTTTAGAGCAGGAGCCATTGAACAACTTA
ATCAGTGAGCAAAGCTGTTAAACTGTGACATTGTACTTCCAAACCCTAAA
GAACAAACTCCAGCTGTTATCTTTCGTGGCGTAAAGAAAGGGATTGATGA
TAAATATGACTTTGTTTTATGTGATACATCAGGAAGATTGCAAAACAAGC
TTAACTTAATGAATGAATTGCAAAAAATTTATCAAATTATTCAAAAGGTA
AGTGGAAGTGAACCTAGTGAAACACTTTTAGTTTTAGATGGTACAGTAGG
TCAAACAGGACTATCACAAGCAAAGGTATTTAATGAATTTTCCAAACTAA
CAGGGATTGTTTTAACTAAAATGGATGGTTCTGCTAAGGGTGGAATTATT
TTAGCTATTAAAGATATGTTTAACCTGCCTGTTAAACTGATAGGTTTTGG
TGAAAAAACTAGTGATTTAGCTATCTTTGATCTGGAAAAATATGTTTTAG
GTTTACTTAATAACTTAAACTTAGATAATAAAGAAAATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1041
View in model
Transcription unit TU_201 View in model
Empirical formula (pH 7.5) H11115C10073N4194O7239P1041
Molecular weight (pH 7.5; Da) 338994.07 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
10832500
pI 3.95
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:23
Last updated 2012-10-01 15:13:23