MG_293 – glycerophosphoryl diester phosphodiesterase

Name
WID MG_293 View in model
Name glycerophosphoryl diester phosphodiesterase View in model
Symbol glpQ
Protein product MG_293_MONOMER
Cross references GenBank: AAC71514.1, CMR: MG_293, BioCyc: MG_293, SwissProt: P47535
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 358151363886 MG_292 MG_293 MG_294 MG_295 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 360651 (nt), Length: 735 (nt), Direction: Reverse, G/C content: 27.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
ATGCATAACAAGCAATTGCTTTTAGCACATAGGGGTTATTCATTCATTGC
TCCAGAAAACACCAAACTAGCATTTGATTTAGCTTTTGAATATTGTTTTG
ATGGAATAGAGCTTGATGTTCATTTAACTAAAGATGAACAGTTAGTTATC
ATTCATGATGAGACAACATTGAGAACCGCATTAGTTAATAAGGAGGTTGA
GTTTGAATCATTAGTTAGTTTAAAAAGAGATGATCATAGTGCTTTTTTTC
ACCTTAAAATTCAATTTCAATCGATCCTAACTTTAAAAGAGTTCTTAGAT
CTTTATTTAGATAAATTTAAGTTAATCAATATTGAGATTAAAACTGATCA
AAAACCATATTTAGGAATTGAAAAGAAGCTTGTTGACCTAGTTAAAGGTT
ATGGTAAAAAAGCAATAGATAAGATCTTGTTTTCATCCTTTAACTTTGAA
TCTTTGCAAAAAGTTTATGATTTAGATAATAGTTACAAAAAAGGTTTTTT
ATTTTGGACTAAAAAACAGTTTGAAACAATTAGTACAGCTAGAATCCAAA
AGATTTGTCAATTCCTCCACCCATGAACCAAAATATATGAAAAGTATCCC
CAAATGATCAAAAAACTTAACTTACCTTTAAATTTATGAACAGTAAACAG
TCAAAATAAGTTTCAGCAGTTCTTAGCTGATAATCATGTTTATGCACAAA
TTGCTAACAAAAAGTTTGAAATAAAAATAAATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
735
View in model
Transcription unit TU_198 View in model
Empirical formula (pH 7.5) H7839C7103N2934O5109P735
Molecular weight (pH 7.5; Da) 238815.27 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7699200
pI 3.97
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:23
Last updated 2012-10-01 15:13:22