MG_288 – protein L

Name
WID MG_288 View in model
Name protein L View in model
Protein product MG_288_MONOMER
Cross references CMR: MG_288, BioCyc: MG_288
 
Classification
Type mRNA View in model
 
Structure
Structure 349291355536 MG_288 MG_289 MG_290 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 351791 (nt), Length: 1245 (nt), Direction: Reverse, G/C content: 28.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
ATGGATTTTGAAGTTGATTATGAAGGTGGTAACAACACTGTTAACTTGCA
ATTTGATTTAAAAGCCCAAACTTCTAATTTTTTGAATTTACAAGAGTTGC
AAAATAGCTTTAATGGTAACGATCTAAATACCCAATTGTTTTGAAAACCT
CTAATTAATAAACTTGTTGATAAAAATCAAAATGATCTCACTTCAATAGC
TAAAACTGCTGTAAGTGATTCACTTTTTCTTTCCAATACAAATATCTTTA
ATTCAGTTTTAAAAATTGATGAACAACTAGATTTAGCTAAAACAAAATTT
GAAAAAGAAATAATTGAACCATTCAAAAAAGAACGTGAAAAAGCTAAAGC
TGATTATGAAGAACAACAACGAATTTTAGCTGAGGAAAGAAGAAAACAAG
AAGAAGAACTTAAGCGAAAAGAAGAGGAAGCTAAGCGCTTAAAAGAACAA
CAAGAACAATTTAATAAATCATTTGAAAATGCTAAAGAATTTAAAGATTA
TTGAAAAAATCAAAAGAAAGATGTTACTGATAAGACTCAACTAATAGATG
CTCTAAAAACTTCTTTTGCTGCTGATAAAAATAAAACTTTTTCACTTTTA
ATTAATAGCTTTACTAAAGCAACGTCAGATTATTACAAAAATAATAAAAA
AGATGAAAGTGAAAATGCAAAGAAAGCCTTTAGTGAAAAAGGAATTCAGT
TTCCTAGACAAGGGCTTGAAGGTCTTTATATGTCTGACTGATTAAGAGGA
AAGCTAACTTCCTATACTGACATAAAACTAAACTTAACAAGCATAAAAAT
TGAAAACAAGGAAAATAATCCAACCATTGATTGAAAAAATAATGGAATTG
AATTTAGGCAACATTATCCATACAAATTTAAATTTGAAATTGACATAAAG
TACCAAGGTGGATACAAATTAACTGGGTTATTTAGTTGATTTGCACCTTT
TTCTGGTATCCCTTCATCATGAAATGGTGAAATGGATGTCAAGTTCATAG
TTGATGGTGATTTGGATTATAACTTAGTTCAAAATACTGATTATCCAGGT
TCTCTATTTCAATTTAAAGACAATCAACTACTTTTCACTTTACACGTAAA
AGAACAGATAAAAGTTCAAGATGGTAAATTTATGGATTTACTTAAACAGC
AAAACTTACATAATTTGGATTTAAGAAATGGGGCTACAAAACCTCCAGTT
GTTGATTTAGCTAGTTATCTGCATTACCTTGTTTTAAACTCATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1245
View in model
Transcription unit TU_195 View in model
Empirical formula (pH 7.5) H13318C12072N5091O8578P1245
Molecular weight (pH 7.5; Da) 405529.73 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.0 (dimensionless) (Show evidence)
View in model
Half life
0.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
13083700
pI 3.76
 
Comments
Comments homologous to protein L [PUB_0057]; 2-oxoacid dehydrogenases E3 subunit; protein L is type II Ig binding receptor [PUB_0171]; binds light chain, preferably of kappa type [PUB_0171, PUB_0172]; protects bacteria from Neutrophils [PUB_0172]; light chain binding proteins have been identified in M. hominis and M. arginini [PUB_0173];
References
  1. . Wikipedia. (2009). WholeCell: PUB_0171, URL: http://en.wikipedia.org/

  2. Akerström B, Björck L. Bacterial surface protein L binds and inactivates neutrophil proteins S100A8/A9. J Immunol 183, 4583-92 (2009). WholeCell: PUB_0172, PubMed: 19752232

  3. Alexander AG, Lowes HR, Kenny GE. Identification of a mycoplasmal protein which binds immunoglobulins nonimmunologically. Infect Immun 59, 2147-51 (1991). WholeCell: PUB_0173, PubMed: 2037376

  4. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  5. Fraser CM, Gocayne JD, White O, Adams MD, Clayton RA, Fleischmann RD, Bult CJ, Kerlavage AR, Sutton G, Kelley JM, Fritchman RD, Weidman JF, Small KV, Sandusky M, Fuhrmann J, Nguyen D, Utterback TR, Saudek DM, Phillips CA, Merrick JM, Tomb JF, Dougherty BA, Bott KF, Hu PC, Lucier TS, Peterson SN, Smith HO, Hutchison CA 3rd, Venter JC. The minimal gene complement of Mycoplasma genitalium. Science 270, 397-403 (1995). WholeCell: PUB_0057, PubMed: 7569993

  6. ... 2 more

  7. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:22
Last updated 2012-10-01 15:13:21