MG_287 – acyl carrier protein

Name
WID MG_287 View in model
Name acyl carrier protein View in model
Symbol acpP
Protein product MG_287_MONOMER
Cross references GenBank: AAC71509.1, CMR: MG_287, BioCyc: MG_287, SwissProt: P47529
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 346383351638 MG_284 MG_285 MG_286 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 348883 (nt), Length: 255 (nt), Direction: Forward, G/C content: 26.3%, Sequence:
1
51
101
151
201
251
ATGCAAACGCATGAAATTCTTTTAAAAATTAAAGAAATTGCTAAATCAAA
AAACTTTAATCTTAATTTAGATGAAAAGACAATAAATCAACCACTTCGTG
AGTTGAAAATCGATTCACTTGATATGTTTAGTATTGTTGTTAGTCTAGAA
AATGAATTTGGGATTAGTTTTGATGATGAAAAGTTAATGAATCTAAAAAA
TCTTGCTGACTTGGTTTTAGAAGTTAAAAACCTTTTAGCAAAAAAAGGGG
TATAG
50
100
150
200
250
255
View in model
Transcription unit TU_193 View in model
Empirical formula (pH 7.5) H2721C2465N1020O1768P255
Molecular weight (pH 7.5; Da) 82820.96 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
7.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2680100
pI 3.95
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:22
Last updated 2012-10-01 15:13:21