MG_280 – sensory rhodopsin II transducer motif

Name
WID MG_280 View in model
Name sensory rhodopsin II transducer motif View in model
Symbol htrII
Protein product MG_280_MONOMER
Cross references GenBank: AAC71502.1, CMR: MG_280, BioCyc: MG_280, SwissProt: P47522
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 338675344473 MG_278 MG_279 MG_280 MG_281 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 341175 (nt), Length: 798 (nt), Direction: Reverse, G/C content: 32.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
ATGGTTATTTTTATTAATCGGTTTTCGAAAACCATCTTGCTTTTCTTTGG
AATGTTGGTTTTTGTATTTCTGTTAGGGTTTGGTATTACTGCTTTGTATT
TTCGTAGTACAGCAGCTAACCTTTATGTTCAAGCTCGTAATTCCATTGAT
AGTTCTTTCAATTCTGCTAAAGCCTTTGCTAATGCTTTAGCAAATAGTGC
TAACCAATTTAGCAAAAGTTCCATTACTAACAATTTAGATCAAGTTAAAA
AAGACTTAGAGCAATCTTTACAAAAAGTGGATGAATACAAAAAGAACTTA
GAGAGTCAGAACAATCTAGGTAATATTAGTCAAGAAAAGATTAGGGAACT
TGATGCAACCAAAAAAGACTTGGAAAACAGTAAAACACAATTAGACAACT
TTAAAAATAATCTTGATAAAAATGGTACTGCTAGTTCATCTCCATCTGTA
AAAAAACAAGCAACAGCTGATGGTGTAATTAGTGCAGTTAGTGAGTTTTC
TACACAAGCACAAAGCATTGTTAGTAGCTATGAAAAGATCAAAAACAACA
TCCCTTCTTCTGAACAGTTCAATAATTATTATGATGTCACAATGATAACC
ATTGTTGCTGTATCAGGTGGGATGTTAGCAATTTTGATTACAACCATTGT
CTTTTCCTTTTTAACTTCTAAAAAAAGAGGATTGATCAGGTTTTCAAGAT
TTATTAGTACTGAACAGTTAGCTGATCATGTTAATGATATCTTAGATCGT
TATCCTGATTTGGAAGAGGAAGTGATAACAGCATTAGACCATGATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
798
View in model
Transcription unit TU_186 View in model
Empirical formula (pH 7.5) H8512C7713N3189O5578P798
Molecular weight (pH 7.5; Da) 259846.89 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
2.98349 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8240200
pI 4.07
 
Comments
Comments In many bacteria participates in multicomponent signaling systems that regulate chemotaxis [PUB_0456, PUB_0457]. Specifically, htrII participates in the pathway: SRII -> HtrII -> CheAW -> CheY -> flagella which helps bacteria avoid photooxidative damage in conditions of bright blue light (
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Klare JP, Gordeliy VI, Labahn J, Büldt G, Steinhoff HJ, Engelhard M. The archaeal sensory rhodopsin II/transducer complex: a model for transmembrane signal transfer. FEBS Lett 564, 219-24 (2004). WholeCell: PUB_0456, PubMed: 15111099

  4. Spudich JL, Luecke H. Sensory rhodopsin II: functional insights from structure. Curr Opin Struct Biol 12, 540-6 (2002). WholeCell: PUB_0457, PubMed: 12163079

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:22
Last updated 2012-10-01 15:13:20