MG_278 – GTP diphosphokinase

Name
WID MG_278 View in model
Name GTP diphosphokinase View in model
Symbol relA
Synonyms spoT
Protein product MG_278_MONOMER
Cross references GenBank: AAC71500.1, BioCyc: MG_278, CMR: MG_278, SwissProt: P47520
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 335867343030 MG_277 MG_278 MG_279 MG_280 MG_281 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 338367 (nt), Length: 2163 (nt), Direction: Forward, G/C content: 31.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
ATGGCAACCATTCAGGAAATCGAGTGTGATTTTTTAGCTAAAATAGCACA
AAAATTTACTAATGCAGAGATTGAATTAATTAACAAAGCATTCTATCACG
CTAAAACTTGGCATGAAAACCAGAAACGGCTTAGCGGTGAACCTTTTTTT
ATCCATCCTTTAAGAACGGCATTATCACTAGTTGAATGGAACATGGATCC
TATCACTATTTGTGCTGGTTTGTTACATGACATCATTGAAGATACAGACC
AAACCGAAGCTAATATAGCAATGATTTTTAGCAAAGAAATTGCTGAGCTT
GTCACTAAGGTTACAAAGATTACCAATGAATCTAAAAAGCAACGTCATCT
CAAAAATAAAAAGGAGAATCTTAACTTAAAAAGCTTTGTTAACATTGCAA
TCAATTCTCAACAAGAGATAAATGTAATGGTACTAAAACTAGCAGATCGA
CTTGATAACATCGCTTCCATTGAGTTTCTCCCCATTGAAAAGCAAAAGGT
AATTGCAAAAGAAACTTTAGAACTTTATGCAAAGATTGCTGGGAGGATTG
GGATGTATCCTGTTAAAACAAAATTAGCAGATCTTTCATTTAAGGTGTTG
GATTTAAAAAACTATGATAACACCCTGTCAAAGATTAACAAGCAAAAGGT
CTTTTATGACAATGAGTGGGATAACTTCAAACAACAATTAAAAAAAATCT
TAGCGCAAAATCAGATAGAATACCAACTTGAAAGTCGGATTAAAGGCATT
TACTCTACATATAAAAAACTAACTGTTCATGAACAGAACATCAGTAAGAT
CCATGATCTTTTTGCTATCCGCTTAATTACTAAATCAGAACTTGATTGTT
ATCACATCCTTGGTTTAATTCACCTTAATTTTTTAATTGACAGTAAATAC
TTCAAAGACTATATTGCCTCACCTAAACAAAACCTTTACCAATCAATTCA
TACCACTGTTCGTTTAAAAGGGTTAAATGTTGAGATCCAAATTAGAACCC
AACAGATGGACAATGTTAGTAAGTTTGGCTTAGCTAGTCACTGGATCTAC
AAAGAACAGAAAGAGGGATTGTTAGCACCTGCTTTGCAACTTAATTACCT
AGTGACAAAACAAAAACACTCACATGATTTTCTAAAAAGGATTTTTGGGA
CTGATATTATCAAGATTAATGTTAGTGCTAGTCATGAACCTAATGTAATT
AAGCAAATTAATGTTGATAGCAACAATAAACTCCTTGATATTGCTTTTGA
AAACTATCCCAAGCAATTTGCTAAATTAACCAAAATTGAAATTGATGGGG
TTGAGATCAATTCTTTTGATACTAGTGTTGAAAATGAGATGCTGATTGAA
TTTTACTTTGGCAAGAATAACAATTTGAAATCAAAGTGAATTAGGTATAT
GAATAACCCTATATACCGTGAAAAGGTAAAAAAGAGCTTGGCTAAACTAG
CTAAATCTGGTAGATACAGTGAGTTAGCTTTTTATGAAAAAGAACTGGGT
GAAAAACAGTTAAAACTTGCTAGTGAAACTGAAATCCAAAAACGCTTAAA
CACCCTAAGAATTAAAAAAATGAGTGATTACTTAGCGTTAATTGAGTGTA
CTAACTTTACTAATGATGAACATTTGTTGTTTCTAGCTAAAAACAACGAC
AAGTGAAATAAACTAACAAAACCACTTAAGTTTGCTTTTTCAAAAGTAGT
TTTTCACAACTCTTACTTTGAACAAATTGAAGGTATTTTTATCACCAAAA
TAGTGATTGAACCATGTTGTAGTAAGATCCCTGATATGCCTGAACAAGTA
ACTGGTATCTTAACTAAAAACATTTTAAGTGTTCACCGTTATGGTTGTAA
GAATTTACAAAATAAAAAGCAGTTAAAAATTATCCCGTTATATTGAAATA
TCCAGCAGTTAAAACTAAAACCACGTAAGTTTCGCAGTTACATTAACATT
AACGGAGTGTGGAGTGAAAAAACCATTAATAAAATCTGTCAAACAATTAT
TAATGGTGATGGTTATATTGAAAAAATAATTCCCAAGATCAACAAACAAA
AAGATGAATTTGATTTAAACATCACCCTTTTTGTTAATAACTACCAACAA
CTTCTCACCTTAATGGACCAAATTACCACTAAGAATATCAGCTTTAGTTG
AAAATACCTTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2150
2163
View in model
Transcription unit TU_185 View in model
Empirical formula (pH 7.5) H23147C20983N8874O14953P2163
Molecular weight (pH 7.5; Da) 705881.19 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
10.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
22475700
pI 3.79
 
Comments
Comments produces (p)ppGpp under starvation conditions (stringent response) [PUB_0149]; ppGpp in turn regulates transcription of rRNA and tRNA, translation, and replication [PUB_0149]; ACP interacts with spoT to shift equlibrium toward (p)ppGpp and away from GTP/GDP and pyrophosphate [PUB_0149]; ribosome-associated (p)ppGpp synthetase responding mainly to uncharged tRNAs that accumulate and binds to ribosomes A-site as a result of amino acid limitation [PUB_0150]; recognizes stalled ribosomes and synthesizes ppGpp [PUB_0153]; ppGpp binds in the secondary channel of RNA polymerase and prevents transcription of tRNA, rRNA [PUB_0151]; ppGpp promotes transcription of amino acid biosynthesis genes [PUB_0151]; ppGpp inhibits DNA primase [PUB_0152];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Braeken K, Moris M, Daniels R, Vanderleyden J, Michiels J. New horizons for (p)ppGpp in bacterial and plant physiology. Trends Microbiol 14, 45-54 (2006). WholeCell: PUB_0150, PubMed: 16343907

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Jain V, Kumar M, Chatterji D. ppGpp: stringent response and survival. J Microbiol 44, 1-10 (2006). WholeCell: PUB_0153, PubMed: 16554711

  5. Potrykus K, Cashel M. (p)ppGpp: still magical?. Annu Rev Microbiol 62, 35-51 (2008). WholeCell: PUB_0152, PubMed: 18454629

  6. ... 3 more

  7. Srivatsan A, Wang JD. Control of bacterial transcription, translation and replication by (p)ppGpp. Curr Opin Microbiol 11, 100-5 (2008). WholeCell: PUB_0149, PubMed: 18359660

  8. Traxler MF, Summers SM, Nguyen HT, Zacharia VM, Hightower GA, Smith JT, Conway T. The global, ppGpp-mediated stringent response to amino acid starvation in Escherichia coli. Mol Microbiol 68, 1128-48 (2008). WholeCell: PUB_0151, PubMed: 18430135

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:22
Last updated 2012-10-01 15:13:20