MG_276 – adenine phosphoribosyltransferase

Name
WID MG_276 View in model
Name adenine phosphoribosyltransferase View in model
Symbol apt
Protein product MG_276_MONOMER
Cross references GenBank: AAC71498.1, BioCyc: MG_276, CMR: MG_276, SwissProt: P47518
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 332356337899 MG_274 MG_275 MG_276 MG_277 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 334856 (nt), Length: 543 (nt), Direction: Reverse, G/C content: 36.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGGATCAAAACTTTAAGTTGCTTGATCAAGCAATCAAGCGCTTTGAAAA
TTTTCCCAACCAAGGTACATTGTTTTATGACATTACCCCAGTATTTTCCA
ATCCCCAACTATTTAATTTTGTGCTAACCCAAATGGCACAGTTTATTAAA
GCTATTAATGCAGAAGCGATAGTATGTCCTGAAGCGAGGGGTTTTATCTT
TGGGGGAGCATTAGCTTCTAAAACCCAACTCCCGTTAGTATTGGTTAGAA
AAGCCAATAAACTCCCAGGGCAATTAATTAGTGCTAGCTATGATTTGGAG
TACAGAAAACATGCTGTATTGGAGATGTCAACCACTTCATTAATCCAAGC
TAATAATGCTAAAAGGTGTGTTATTGTTGATGATGTACTTGCCACTGCTG
GAACAGTTGCTGCTATTGACCAATTACTTAAACAGTTAAATGGTGAAACT
GTGGGATATTGCTTTTTAATTGAGCTGAAAAAACTCAATGGTAAAGCTAA
GTTACAACCAAATGTGGTTAGCAAGATTTTATTACATTACTAG
50
100
150
200
250
300
350
400
450
500
543
View in model
Transcription unit TU_183 View in model
Empirical formula (pH 7.5) H5803C5259N2202O3798P543
Molecular weight (pH 7.5; Da) 177440.36 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5514000
pI 4.02
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:22
Last updated 2012-10-01 15:13:19