MG_268

Name
WID MG_268 View in model
Protein product MG_268_MONOMER
Cross references GenBank: AAC71490.1, CMR: MG_268, BioCyc: MG_268, SwissProt: P47510
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 322693328380 MG_266 MG_267 MG_268 MG_269 MG_270 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 325193 (nt), Length: 687 (nt), Direction: Reverse, G/C content: 31.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGCAACTAAAAAAGCCCCATTTTCAACCAAATAAAATTGCTAATTGTAT
TGTGATCGGGGGAATGATTGCTTTAGGAAAAACCACCATTGCTAATACAT
TAGCTAACCACATTCAAGCTGCAAAAGTTGTTTGTGAATTGGAAACTAAT
GACCAGTTGGTTGAACTTTTACTAGCAAAGATGTATGAACGTAGTGATGA
ATTGCTCTATTCACCTTTGTTTCAGCTTTATTTTACGCTTAATCGCTTTG
GTAAATACCAGAACAATTGCAACACTATCAATCCAACCATTTTTGATCGT
TCTATCTTTGAAGACTGGTTGTTTGCTAAGCACAACATCATTCGTCCTGC
AGTCTTTTCATACTATAACCAACTGTGAAATAGATTAGCAAAAGAACTAG
TTAATAAGCATGGGGTTCCTAATTTATATGTCATTTTGGATGGGGATTGA
AAATTATTTGAAAAAAGACTATTTATGCGTAACCGCAAAGTAGAGATTGA
TAACTTTACTAAAAATCAACTTTACTTTCAAAATTTACACAGGGTTTACA
CTGGATTTATGGAAGCGGTTTGTAATGATTTTGGGATTAATTACTGTATT
ATAGATGCAAAACTACCAATAGTAACTATTATTAAAATGATCCTTGAAAA
ATTAAAGTTACAAAAGTTAGATTGAAAATTTATCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
687
View in model
Transcription unit TU_177 View in model
Empirical formula (pH 7.5) H7328C6640N2745O4800P687
Molecular weight (pH 7.5; Da) 223661.45 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
3.86375 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7066800
pI 4.04
 
Comments
Comments similar to deoxynucleoside kinase (dnk) [PUB_0182, PUB_0190]; catalyzes the phosphorylation of deoxyribonucleosides to yield corresponding monophosphates (dNMPs) [PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Bizarro CV, Schuck DC. Purine and pyrimidine nucleotide metabolism in Mollicutes. Genet Mol Biol 30, 190-201 (2007). WholeCell: PUB_0190, URL: http://www.scielo.br/scielo.php?script=sci_abstract&pid=S1415-47572007000200005&lng=en&nrm=iso&tlng=en

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Peterson JD, Umayam LA, Dickinson T, Hickey EK, White O. The Comprehensive Microbial Resource. Nucleic Acids Res 29, 123-5 (2001). WholeCell: PUB_0182, PubMed: 11125067, URL: http://cmr.jcvi.org/

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:22
Last updated 2012-10-01 15:13:18