MG_265 – sugar phosphatase

Name
WID MG_265 View in model
Name sugar phosphatase View in model
Symbol ybiV
Protein product MG_265_MONOMER
Cross references GenBank: AAC71487.1, CMR: MG_265, BioCyc: MG_265, SwissProt: P47507
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 319078324915 MG_263 MG_264 MG_265 MG_266 MG_498 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 321578 (nt), Length: 837 (nt), Direction: Reverse, G/C content: 29.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGGAACTGAAAAACATTATTTTTGACCTTGATGGTACCTTGCTTTCAAG
CAACCAAATTCCATTAGAACAAACAGTTGAGTTTTTAAAGGATTTACAGA
AAAAAGGGATTAGAATCACTTTTGCTAGTGGTAGAAGCCATATTTTAATT
AGAAACACAGCTACCTTTATTACACCAAATCTACCTGTAATTTCTTCCAA
TGGTGCACTTGTTTATGATTTTGCTAGTGAAAAACCAGTTCATATCAAAC
CTATTGATAATAAAGTAATACCTGCAATTATGCAAATGTTGTTGGAATTT
CAAGAAACATTTTATTTCTATACAGATAAAAAGGTTTTTGCTTTTACACA
TGAGCTTGATTCAGCTAAAATTCTTTCAACTAGAAGTCAAATAGTAGGAA
TTGATCTCATTGAAAATAACTACATAGTTAACAAGTTTGAAAAAGCTTTG
GATTTTGATTTTAAGCAACATACTATTACAAAGATCTTACTGGTAACTAA
AAACAGAGAAAAAGTTCCTTTTCTAGCAAAACAACTAGATCAAATTCAAG
ATATTAACTATGTGAGTTCAATGACATTTGCTCTTGATATCATGCAAAAA
GATGTTAATAAGGCTTATGGATTGAAAGTATTAGTTGATAATTATAATCT
TGATCCTGAAAAGACTATGGTCTTTGGTGATGCTGATAATGATGTTGAAA
TATTTCAAAGTGTTAAATGGCCAGTTGCTTTGGTTAATGGCACTGATTTA
GCTAAAAAAAATGCTAAGTTTATTACTGAATATGACAACAATCACAACGG
CATTTATTTCTTTCTAAAAAAGTTTCTAGCAACTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
837
View in model
Transcription unit TU_176 View in model
Empirical formula (pH 7.5) H8924C8086N3333O5838P837
Molecular weight (pH 7.5; Da) 272126.92 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
5.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8675700
pI 4.03
 
Comments
Comments HAD-like hydrolase superfamily, HAD phosphatase [PUB_0106]; HAD phosphatases have broad and overlapping substrate spectra [PUB_0108]; most HAD proteins have phosphatase activity [PUB_0108]; several HAD catalyze dehalogenase (C-halogen bond hydrolysis), phosphonatase (C-P bond hydrolysis), and ß-phosphoglucomutase (CO-P bond hydrolysis and intramolecular phosphoryl transfer) reactions [PUB_0108]; several additional functions have been annotated for HAD proteins -- lipopolysaccharide biosynthesis, degradation of 2-phosphoglycolate produced during DNA repair, biosynthesis of serine, detoxification, glycation repair to free proteins from the glycation products derived from direct nonenzymatic glycosylation [PUB_0108]; HAD phosphatases have broad and overlapping substrate spectra [PUB_0108]; none of the HAD proteins are essential in E. coli [PUB_0108];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Kuznetsova E, Proudfoot M, Gonzalez CF, Brown G, Omelchenko MV, Borozan I, Carmel L, Wolf YI, Mori H, Savchenko AV, Arrowsmith CH, Koonin EV, Edwards AM, Yakunin AF. Genome-wide analysis of substrate specificities of the Escherichia coli haloacid dehalogenase-like phosphatase family. J Biol Chem 281, 36149-61 (2006). WholeCell: PUB_0108, PubMed: 16990279

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  5. Zhang-Akiyama QM, Morinaga H, Kikuchi M, Yonekura S, Sugiyama H, Yamamoto K, Yonei S. KsgA, a 16S rRNA adenine methyltransferase, has a novel DNA glycosylase/AP lyase activity to prevent mutations in Escherichia coli. Nucleic Acids Res 37, 2116-25 (2009). WholeCell: PUB_0106, PubMed: 19223326

 
Metadata
Created 2012-10-01 15:07:21
Last updated 2012-10-01 15:13:18