MG_264 – dephospho-CoA kinase

Name
WID MG_264 View in model
Name dephospho-CoA kinase View in model
Symbol coaE
Protein product MG_264_MONOMER
Cross references GenBank: AAC71486.1, CMR: MG_264, BioCyc: MG_264, SwissProt: P47506
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 318546324143 MG_262 MG_263 MG_264 MG_265 MG_266 MG_498 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 321046 (nt), Length: 597 (nt), Direction: Forward, G/C content: 30.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGTTAATTGCAATCGTAGGTAAACCAGGTGTTGGTAAAACCAGTCTATT
GCAATATCTCAAAGATAACTATCACTTTTCAGTTTTTTATGCAGATAGTT
TTATCCATGAACAGTACCAAAAAAACAATCCAGGTTATCAATTAATCATG
GATCATTTTGGCAAAGAGTTTGTCAATCAAACTGAAGTTGATCGTAAAAA
ACTAGCAAACTATGTTTTTAGTGATGATAAGTTAATCGAAAAACTTTCAC
TAGTAACAAAACCGCTGTTAATAGCGTGAATCAAATCCTTAAAAACCCAG
TTTCAAAAAAAGCTAGCACTAATAGAGATTGCTGTGATGCTTAACTATTG
AAATGAATATAGATCGTTGTTTGATTATGTGATTAAATTAGAAAGGGATG
ATCAGCTAGTTAACTTAGCTTTACAACAACGTAATAGTCATAAAAAAGTT
AAGGATTTGATTAAAGAGCCTAATTGCAAAATAGATACAATTTTCAACAA
CGATTCGATTGCAACAGCTGCTTTAAAGCTAATTAAGTTGCTAGAAACTT
TTTTAGAAAGAAATAAATGCCGTTGTGATTGTTGTCATATTCAGTAA
50
100
150
200
250
300
350
400
450
500
550
597
View in model
Transcription unit TU_175 View in model
Empirical formula (pH 7.5) H6379C5781N2418O4143P597
Molecular weight (pH 7.5; Da) 194508.32 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6218500
pI 3.90
 
Comments
Comments First annotation was GND [PUB_0057]; this gene is probably expressed but no GND activity detected [PUB_0444];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Cordwell SJ, Basseal DJ, Pollack JD, Humphery-Smith I. Malate/lactate dehydrogenase in mollicutes: evidence for a multienzyme protein. Gene 195, 113-20 (1997). WholeCell: PUB_0444, PubMed: 9305754

  3. Fraser CM, Gocayne JD, White O, Adams MD, Clayton RA, Fleischmann RD, Bult CJ, Kerlavage AR, Sutton G, Kelley JM, Fritchman RD, Weidman JF, Small KV, Sandusky M, Fuhrmann J, Nguyen D, Utterback TR, Saudek DM, Phillips CA, Merrick JM, Tomb JF, Dougherty BA, Bott KF, Hu PC, Lucier TS, Peterson SN, Smith HO, Hutchison CA 3rd, Venter JC. The minimal gene complement of Mycoplasma genitalium. Science 270, 397-403 (1995). WholeCell: PUB_0057, PubMed: 7569993

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:21
Last updated 2012-10-01 15:13:18