MG_262 – polI-like 5'-3' exonuclease, putative

Name
WID MG_262 View in model
Name polI-like 5'-3' exonuclease, putative View in model
Symbol polA
Protein product MG_262_MONOMER
Cross references GenBank: AAC71483.1, CMR: MG_262, BioCyc: MG_262, SwissProt: Q49406
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 315832321708 MG_261 MG_262 MG_263 MG_264 MG_498 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 318332 (nt), Length: 876 (nt), Direction: Forward, G/C content: 30.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGAAAAAAGCAATCCTGATTGATGGCAATTCCTTAGCATACCGTGCTTA
TTTTGCAACGTGAAAACAAGTTGAATATGCTAAGCAAAATAATTTACCTT
TCAATAATGCAATAAGAACAATGTTACTAATGTGTTGGAATTTAATTAAA
GCCAATGTTTATCAATATGGAATTGTAAGTTTTGACACTAAAGCGCCAAC
TTTCCGTGATCAAATCTATGAAGGATATAAACAAAAAAGGGTTAAAACTC
CAGTTGAACTTTTAGTACAAATTCCTCTAATTAAACAAGCGCTTGTTTAT
TTAGGGTTTTTAGTTTGTGAAAAAGATGGCTTTGAAGCAGATGATTTGAT
TGGTAGTTATGCCAATTTATTTACAAAGCAAGAAATAACAGTTGATATTT
ACAGTTCAGATCGAGATATGTTGCAATTAGTAAACGCCTTTACTAATGTG
TTTCTCTGTATTAAAGGTACAAAGGAGATGGTTATGTACAACAATGAAAA
TTTCAAATCACTTTTTTATGGTTTGGCGCCCTATCAAGTTGTTGAATATA
AGGGGTTAGTTGGTGATAACAGCGATAATTTAGCAGGGATTAAAGGGATA
GGTCCCATCAAAGGGATAGAATTACTCCAACAATATGGAACCATTGATAA
CATCTACACTAACTTCAATAATCTCCCCAACCAACTTCAAAAACTTTTAA
ATAACCAAAAGGAAATAGCTAAAACCTTTAGTTTTCTAGCTAAAATTAAA
ACTGATATTGAACTTGATCAAAACATAGATCTTACTGGTTTAAAACCAAT
CCAAAAACAAGCGTTAATTCAACTTCTAAGTGAAAACAAAATTAATACTT
TAGTTGAAAAATTTTCAAAAATATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
876
View in model
Transcription unit TU_173 View in model
Empirical formula (pH 7.5) H9362C8485N3555O6074P876
Molecular weight (pH 7.5; Da) 285453.97 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9114600
pI 3.88
 
Comments
Comments polI-like 5'-3' exonuclease [PUB_0072] possibly responsible for DNA resection in the initiation of homologous recombination repair. Homologous recombination is most efficient for overhang lengths of at least 8 bases [PUB_0526]. Also has weak homology to flap endonucleases involved in long-patch base excision repair.
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Carvalho FM, Fonseca MM, Batistuzzo De Medeiros S, Scortecci KC, Blaha CA, Agnez-Lima LF. DNA repair in reduced genome: the Mycoplasma model. Gene 360, 111-9 (2005). WholeCell: PUB_0072, PubMed: 16153783

  3. Daley JM, Wilson TE. Rejoining of DNA double-strand breaks as a function of overhang length. Mol Cell Biol 25, 896-906 (2005). WholeCell: PUB_0526, PubMed: 15657419

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:21
Last updated 2012-10-01 15:13:17