MG_257 – ribosomal protein L31

Name
WID MG_257 View in model
Name ribosomal protein L31 View in model
Symbol rpmE
Protein product MG_257_MONOMER
Cross references GenBank: AAC71477.1, CMR: MG_257, BioCyc: MG_257, SwissProt: P47499
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 305137310431 MG_255 MG_256 MG_257 MG_258 MG_259 MG_494 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 307637 (nt), Length: 294 (nt), Direction: Forward, G/C content: 37.1%, Sequence:
1
51
101
151
201
251
ATGAAAAAGGCAATCCACTTTCAGAGTCAACCAGTTGTTTTTAACTGTGC
TTCATGCAATAGCAACTTTACCATTGACTCCACTGCCAAACAAAAGGATC
TTGCCATTGACATTTGTGGAAAATGTCATCCTTTTTACATAGGGCAATTA
ACCAAACAAACCGTGCATGGACGGGCTGAAAAACTTTCTCAAAAGTTCAA
CGCTGGAAAGGCTTTTTTAGAAAATAAAACTAAAAAGAGTAACCAAGCTA
AAGTTGAAAAACAAACTAGGCACCGTTCTATTAACGAGCTTTAG
50
100
150
200
250
294
View in model
Transcription unit TU_170 View in model
Empirical formula (pH 7.5) H3158C2863N1239O2028P294
Molecular weight (pH 7.5; Da) 96476.96 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
5.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2967300
pI 3.66
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:21
Last updated 2012-10-01 15:13:16