MG_252 – 23S rRNA methyltransferase; G2251

Name
WID MG_252 View in model
Name 23S rRNA methyltransferase; G2251 View in model
Symbol rlmB
Synonyms yjfH
Protein product MG_252_MONOMER
Cross references GenBank: AAC71472.1, CMR: MG_252, BioCyc: MG_252, SwissProt: P47494
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 298324304053 MG_250 MG_251 MG_252 MG_253 MG_254 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 300824 (nt), Length: 729 (nt), Direction: Reverse, G/C content: 31.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
ATGAAAAAACCACGCCAACAAAGTTGCTTATTTGGTGTTAAAGCCTTTGA
GGAAGCGATTAATAACCAAGTTCACATTAAATTGGTAAACATTTCCATTC
GTCACAAAAAACTAATACCTTTAATTGAAGCTAAAAAAATTAATTTTCAA
ATCCATTCAACTAACTGATTTAACAATCAGTATAGAGATATTAACCACCA
GGAATTGGTAGCAGTTTTAGATACTAACCAACTCTTAATTCCACTTGATC
AACTGGTTAAAGTAGTTGAAAATAAGAAGTGCAGTACACTTGTGATGTTA
GATGAGATCCAAGACCCTTATAATTTTGGTGCTATACTAAGAACTTGTTT
GGCTAGTGAGGTTGATGGAATTATCTTTAAAAAGAATAACCAAGTCCCTA
TCAACAATACAGTCATGAAAACTAGTATGGGTAGTGTTTTTTATCAAAAC
TTAGTGCAAGTAGCTAACTTAAGTTATACGATCACTAAGCTAAAAGAAAT
AGGATTTTGAACTGTTGTTTCAACTCTGGATCCTATTTGAAAACCAATTG
ATTATCGCAAAGTTGATTTTGCTAAAAAAATCTTAATTGTTGGCAATGAG
GATAGGGGTGTGAATCAACTAATAACAAAGAATGCAGATTGTAGAATCAA
AATTCCTATGAACAATAAGATCAATTCTTTAAATGTAAGTGTTGCTTTAG
GGATTATCTTGTTTGCTTGAAAAAACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
729
View in model
Transcription unit TU_165 View in model
Empirical formula (pH 7.5) H7790C7060N2955O5062P729
Molecular weight (pH 7.5; Da) 237605.74 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
3.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7571300
pI 3.90
 
Comments
Comments catalyzes 2'-O methyltransfer of Gm2251 modification of 23S rRNA [PUB_0105];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Peil L. Ribosome assembly factors in Escherichia coli. Tartu University (2009). WholeCell: PUB_0105, URL: http://dspace.utlib.ee/dspace/handle/10062/10503

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:21
Last updated 2012-10-01 15:13:16