MG_245 – 5-formyltetrahydrofolate cyclo-ligase, putative

Name
WID MG_245 View in model
Name 5-formyltetrahydrofolate cyclo-ligase, putative View in model
Protein product MG_245_MONOMER
Cross references GenBank: AAC71465.1, BioCyc: MG_245, CMR: MG_245, SwissProt: P47487
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 290948296446 MG_243 MG_244 MG_245 MG_246 MG_247 MG_248 MG_249 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 293448 (nt), Length: 498 (nt), Direction: Forward, G/C content: 25.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGGTTGATAAAAACAGTTTAAGAAAATTAATGCTTCTAAAAAGAGCAGA
ACTAAATGATCTTGAAAAATCGCATTTAGATCAAAAGATTAACCAAAAAT
TAATGGCTTTTTTAATAACAAGACCAACAATTAAAAATTTAGCACTTTAC
ATTCCCATTAAAAACGAAGTGGCTTTTTTAGATAACTTTCTAGATTTTCT
TAAGTTAAATAAAATTACAAGCTGTTTTCCTAGTATTGTTGATCAATTTA
ACATGAAGTTTATTGATCAAAATAATAATGAAATTAACCCTAATGATATT
GATTGTTTTTTTATCCCTTTATTAGCTTTTAATAAGGCAAACCACAGGAT
TGGTTTTGGTAAGGGTTATTATGACCGTTATTTATCATTAACTAGCAAAA
AACAACTAAAAATAGGGATAGCATATGACTTTCAATATGCAGAATTCACT
AATGATCCTTGGGATTATCAATTAGATTTAATTATTTGCAATGGATAA
50
100
150
200
250
300
350
400
450
498
View in model
Transcription unit TU_160 View in model
Empirical formula (pH 7.5) H5304C4805N1965O3468P498
Molecular weight (pH 7.5; Da) 161491.35 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5215400
pI 4.03
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:21
Last updated 2012-10-01 15:13:15