MG_244 – 3-5' helicase

Name
WID MG_244 View in model
Name 3-5' helicase View in model
Symbol pcrA
Synonyms recB, uvrD
Protein product MG_244_MONOMER
Cross references GenBank: AAC71464.1, BioCyc: MG_244, CMR: MG_244, SwissProt: P47486
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 288834295946 MG_242 MG_243 MG_244 MG_245 MG_246 MG_247 MG_248 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 291334 (nt), Length: 2112 (nt), Direction: Forward, G/C content: 28.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
ATGAATGAACAACAAAAACAAGCAATTAGTTGTGGAAAAGGGGTTAATGT
TGTTTATTCTGGAGCAGGTACTGGTAAAACAACAATTATTACTAATCGCT
TTGCATACTTGGTTAATAAAGAAAAAGTTGATCCTAGCAGAATTTTAGCA
ATCACCTTTACTAAGAAAGCTGCTAAGGAGATGCAGTTTAGAATCTTGAA
ACTAATAGATAGTTCTTTAGCTGAGAAAACAAATATCTATACATTTCACA
GCTTTTGCAATAAGTTTTTAATTCAAACATTAAAAAAGCGCTTTATCATC
GATGATGATATTAGCTATTTCCTAAAGGAATTTTTAGCTGATTCAAAACT
CGATATCAACCTAGCGAAACAAATTATTGATAACTTTAAAAATACTTTTG
CTGATTTTGAAATAAATAAGTTGGATCAAGATGAAAGGTTAATTAGTTTA
TGTGAGCATTCACTTCTAAATAAAGATGAAGAATATTCCACTTTAAAAAC
CCAACTGATTAATGCATTCATTAGCTATGAAAAGAATAAGATATTAAACA
ATAAACTTGATTTTCATGATCTTTTAATTAAAACTTGTAATTTATTGAGT
AATGATAATGATTTACTTAATCAGTGGAGTGAACAGTTTCAGCATATTTT
AGTTGATGAATTTCAAGATACCAACCAAATCCAATATGAACTGATCAAGA
TGTTAGTAACTAAAAATAAAAACTTGTTTTTGGTAGGTGATAATAACCAG
ATGATTTACCGCTGAAGAGGGGCGGTAAACGGGATCATAACTGCTTTAAA
GCATGACTTTAATGTTCCGAAAAGCAATGAATTCTTTATTAATCAAAATT
ACCGTTGCGATCAGAATATTTTAGCAGTTGCTAACCAAATTCTTTTAAAA
ATTATGGCCTATGAAAAACAAGTTAAAACTGAAAAAAATCTCTTGTTTTC
AACTTTAAATTCTGATAAAAAACCTGTTTATTTTCAAGCTGAATCAGTTG
AAAATCAAGCCAATTGGATCTTCAATAAAATCAAAGCACTAAACCAAACA
GAAAAGATTAATTTTAAGGATATGGCCATCTTGTTTAGAAAGAACAGAGA
TATTACTACTATGGTTGAATTGATTGAAGCGGATGGAACAATTCCCTTAC
CTAAACAAAAGAGTTATTTTAACCAACTAGTAAAACTCCAGCGGGTTTTA
ATTGCGATTTCAACCAGAACAAATCTTGATATTAAAAGAGCTTTGCAAGC
CCTAAAAATTTGATCAAATGATTTAAAGGAATTGTGAAAACAGAGTGATA
AAACAAACCTATTTGATTTTCTTAAATGATCAGAATTAAATCAAAAAAAC
CATAGTTCAAAACTTAAAGCTACTGGTTATTTTAATCTGCTGATTAAGTT
AGCAGAGGATCAGCAAATTAACCTTTTGTTTACTGAACTGTTTAAAAAAC
TCAAAGTGGATCAAACTATTGAAAATCTGCTTTGAAAAAAACTAACTGAA
TTTCAAAAAGATAAAACTGAATTTAGCTTATCAGAGTTTATTACTAGCTT
AGCATTGGAATTTGACTCAATTATTGAAAACAGCAGTGATACAATCAATT
TGCTAACCGTTCATGCAGCAAAAGGACTTGAGTTTGAAGCTGTATTTATT
TATGGCATGAATCAAGGGGATTTTCCCTTATTTTTAAGTCAAAATCAAAA
TGACGAACAACATTTAATTGATGAATTAAAACTGTTTTATGTTGCTATCA
CAAGAGCAAAACGTTTTTTGTTTATCACTGCGGTTTTACAAATAAATAAC
AATTCTATAAAACCATCTAGTTTTTTAAATTACATCAATAAAAGTGAGTA
TTTAGACATTGCTACTATTAACTATGTATTAGAGCAGGATGATGATTTTT
TTGATTCAACTAAAAAAACAGACTATACAAAGAAACTAAGAAAAGAAAGT
TTAGACATTATAGTGGGTGATTTAGTTACTAGTAGATACTTTGGAAAAGG
AGTTGTAGTTGAAGTGAGAGACAAAGAGGTTTTAGTAGCTTTTAAAGACA
CACGCTATGGGATGAAATGGATCTTAAAAAACCATAAATCACTAACAAAA
GCTTTATATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2112
View in model
Transcription unit TU_159 View in model
Empirical formula (pH 7.5) H22558C20445N8535O14634P2112
Molecular weight (pH 7.5; Da) 687394.04 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
3.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
22135800
pI 3.88
 
Comments
Comments PcrA is a 3-5' helicase that removes oligonucleotides cleaved by UvrABC during nucleotide excision repair [PUB_0072]. Oligonucleotide excision is powered by ATP hydrolysis [PUB_0531]. Several groups have studied PcrA energetics and kinetics. Wigley report that 1-23 bases are excised per ATP [PUB_0541]; Tomko et al report that PcrA catalyzes excision at the rate 193 nt/s and 1 ATP/nt [PUB_0516]. PcrA is active as a dimer [PUB_0541]. Additionally, PcrA may play a role in the initiation of recombination repair with pol I exonuclease [PUB_0072]. pcrA is also homologous to recB [PUB_0072].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Carvalho FM, Fonseca MM, Batistuzzo De Medeiros S, Scortecci KC, Blaha CA, Agnez-Lima LF. DNA repair in reduced genome: the Mycoplasma model. Gene 360, 111-9 (2005). WholeCell: PUB_0072, PubMed: 16153783

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Panyutin IG, Hsieh P. The kinetics of spontaneous DNA branch migration. Proc Natl Acad Sci U S A 91, 2021-5 (1994). WholeCell: PUB_0531, PubMed: 8134343

  5. Tomko EJ, Fischer CJ, Niedziela-Majka A, Lohman TM. A nonuniform stepping mechanism for E. coli UvrD monomer translocation along single-stranded DNA. Mol Cell 26, 335-47 (2007). WholeCell: PUB_0516, PubMed: 17499041

  6. ... 2 more

  7. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  8. Wigley DB. DNA helicases: one small step for PcrA, one giant leap for RecBC?. Curr Biol 10, R444-6 (2000). WholeCell: PUB_0541, PubMed: 10873794

 
Metadata
Created 2012-10-01 15:07:20
Last updated 2012-10-01 15:13:14