MG_238 – trigger factor

Name
WID MG_238 View in model
Name trigger factor View in model
Symbol tig
Protein product MG_238_MONOMER
Cross references GenBank: AAC71459.1, BioCyc: MG_238, CMR: MG_238, SwissProt: P47480
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 279493285828 MG_235 MG_236 MG_237 MG_238 MG_239 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 281993 (nt), Length: 1335 (nt), Direction: Forward, G/C content: 32.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
ATGAAGTTATACAAAGTTCTTAACAGTAAAACAACTGATAAAAGTCTTTG
TTTGGAAGTTGAGATTGATCCAAATTACTGACAAGCTACCCAAAAAAAAC
TAGTAGGTGAAATGGCTAAATCGATAAAAATTAAGGGTTTTCGTCCCGGT
AAAATCCCCCCTAATTTAGCCAGTCAGTCGATTAATAAAGCTGAATTAAT
GCAAAAAAGTGCCCAAAACGTCATGAACAGTATTTATGAATCAGTTCAAC
AAGAAGAGATCGTTGCTAGTAATGATAATGTCATTGATGATTATCCTACC
ATTGATTTCAAAACGATCACTGAACAAAACTGTGTACTTTTGTTTTACTT
TGATCTGATCCCTAACTTTCAACTCCCTGATTACAAAAAGATAAAAGATT
TAACACCACTTACCAAGTTAACTGAAGCTGAATTTAACAACGAAATTGAA
AAGCTGGCAAAAACTAAAAGCACAATGGTAGATGTTAGTGATAAAAAACT
AGCTAATGGTGATATTGCTATCATTGATTTCACTGGGATAGTTGATAACA
AAAAACTAGCATCAGCTTCAGCACAAAACTATGAATTGACAATTGGTTCA
AATAGCTTTATTAAGGGTTTTGAAACCGGGTTAATAGCAATGAAAGTTAA
CCAGAAAAAAACTTTAGCACTAACTTTTCCTAGTGATTATCATGTTAAGG
AGTTGCAATCAAAACCAGTTACATTTGAAGTAGTTTTAAAAGCAATTAAA
AAACTGGAATTCACCCCAATGGATGAAACTAATTTCAAATCCTTTCTCCC
TGAACAATTCCAAAGCTTTACTTCTCTAAAGGCATTTAAGAGTTATTTTC
ATAAGCTAATGGAAAACAAAAAACAAGAGACAATTCTCCAGGAGAATAAC
CAAAAAATTCGTCAGTTCTTACTTACTAATACCAAACTTCCTTTTCTTCC
AGAAGCGTTAATTAAACTAGAAGCTAACCGCTTGTTAAAGCTCCAGCAAA
GCCAAGCTGAACAATATAAAATCCCCTTTGAAAAACTCTTAAGTGCTTCT
AATATCACCCTAACAGAGTTACAAGATCGCAACATAAAAGAAGCTAAGGA
AAATGTTACCTTTGCTTTGGTAATGAAAAAGATAGCTGACATTGAAAAGA
TTAAGGTTGATAATAACAAGATTAAAGCTGAAATTGAAAATGTTATTGCT
GTTGAATATCCCTTTGCTAGTGATGAAATGAAAAAACAACTCTTTTTTAA
TATGGAACAACAAAAGGAGTTTGTGGAATCAATTATCATCAACAGATTAA
CAACAACTAAAATCGTTAGCTATTCAACTCATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1335
View in model
Transcription unit TU_154 View in model
Empirical formula (pH 7.5) H14304C12968N5529O9204P1335
Molecular weight (pH 7.5; Da) 436223.30 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
4.05584 (dimensionless) (Show evidence)
View in model
Half life
2.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
13833400
pI 3.73
 
Comments
Comments Trigger factor binds translating ribosomes [PUB_0005]: Trigger factor concentration: 50 μM Ribosome concentration: 30 μM Trigger factor-50S ribosome: KD=1 μM Trigger factor-trigger factor: KD=1-2 μM Trigger factor binds ribosome 10 s Trigger factor remains bound to polypeptide for up to 35 more seconds after dissociates from ribosome
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Kaiser CM, Chang HC, Agashe VR, Lakshmipathy SK, Etchells SA, Hayer-Hartl M, Hartl FU, Barral JM. Real-time observation of trigger factor function on translating ribosomes. Nature 444, 455-60 (2006). WholeCell: PUB_0005, PubMed: 17051157

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:20
Last updated 2012-10-01 15:13:14