MG_236 – ferric uptake repressor

Name
WID MG_236 View in model
Name ferric uptake repressor View in model
Symbol fur
Protein product MG_236_MONOMER
Cross references GenBank: AAC71457.1, CMR: MG_236, BioCyc: MG_236, SwissProt: P47478
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 278164283587 MG_231 MG_232 MG_233 MG_234 MG_235 MG_236 MG_237 MG_238 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 280664 (nt), Length: 423 (nt), Direction: Forward, G/C content: 35.0%, Sequence:
1
51
101
151
201
251
301
351
401
ATGCTAACTAGTTATGTGAAGGTATTAGAACAAAACAATCTGCGCTTAAC
AAAACCGCGGATTGCTTTATTAAAGTGTTTAATTGAACACCAAGATTGGC
ATAATCTCTCCCAAATTAAAACCCACCTTGATTTAGCCAATCAACCCTCA
ACACTCGCTTCTATCTACAACAACTTAAGAATCCTAGCTAAACTTAAACT
GATTAACATCTTTGTAGATCCAGAGCGGTTTGAAACTTACTATTGCCTGC
GCCATGCAGAGCATAACCATATCTATCTTTTTGATGAAGTTAAACAGCAG
TTTTTTACCTTACCTTTAACAGATGGCCAAATTAAAACATTGCTTGAAAC
CCAAAACCATACCAGTAAGGTAAAGCTTAATGATTTTTATATTGTTGCTA
GGGGTGAGATAAACAATGATTAA
50
100
150
200
250
300
350
400
423
View in model
Transcription unit TU_152 View in model
Empirical formula (pH 7.5) H4527C4103N1734O2941P423
Molecular weight (pH 7.5; Da) 138286.44 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4272500
pI 3.84
 
Comments
Comments HTH_ARSR Super-family of metal regulated homodimeric transcriptional repressors [PUB_0110]; homologous to ferric uptake regulation protein (fur) of M. pneumoniae;
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:20
Last updated 2012-10-01 15:13:13