MG_234 – ribosomal protein L27

Name
WID MG_234 View in model
Name ribosomal protein L27 View in model
Symbol rpmA
Protein product MG_234_MONOMER
Cross references GenBank: AAC71455.1, CMR: MG_234, BioCyc: MG_234, SwissProt: P47476
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 276992282307 MG_231 MG_232 MG_233 MG_234 MG_235 MG_236 MG_237 MG_238 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 279492 (nt), Length: 315 (nt), Direction: Forward, G/C content: 40.3%, Sequence:
1
51
101
151
201
251
301
ATGAGTAAAAACAGTTACTGCTACCAAATTAACTTACAGTTTTTCGCTTC
CAAAAAAGGGGTTGGTTCCACTAAGAATGGACGTGATTCACATTCTAAGC
GCTTGGGCGCTAAGAAGGCAGATGGTCAGATGATTAGAGTTGGTCAGATT
ATCTATAGACAAAGGGGAACTAAGATCTTTGCAGGACAAAATGTTGCAAT
GGGTAGTGATAACACCCTCTTTGCTTTGAGCGATGGCATTGTCCGCTTTC
AAAAGTTTGGTAGTAAACAAAGCAAAACCCGGGTTAACATCATCAAACAC
CAACTAAATGCCTAA
50
100
150
200
250
300
315
View in model
Transcription unit TU_152 View in model
Empirical formula (pH 7.5) H3383C3067N1326O2184P315
Molecular weight (pH 7.5; Da) 103518.86 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
3.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3186400
pI 3.76
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:20
Last updated 2012-10-01 15:13:13