MG_230 – ribonucleotide reductase stimulatory protein

Name
WID MG_230 View in model
Name ribonucleotide reductase stimulatory protein View in model
Symbol nrdI
Protein product MG_230_MONOMER
Cross references GenBank: AAC71451.1, CMR: MG_230, BioCyc: MG_230, SwissProt: P47472
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 273667279129 MG_227 MG_228 MG_229 MG_230 MG_231 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 276167 (nt), Length: 462 (nt), Direction: Forward, G/C content: 34.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGCATAAAGATATCAAACTAGTTAAGGAAACTGAAATTAGAAAACCAAT
TGGTTCTCCTTTTATTGTCTATTTTTCATCTATCTCCAACAACACCCACC
GTTTTATTGAAAAACTGGGTTTTCAACACAAAAGAATCCCAGTTGATATA
ACCCAAAGCATTACTGTAAGTAATGAGTATGTTTTAATCTGTCCAACTTA
TAGTGGTGGGGGTAACCAGGTTGAAGGAGCGGTACCCAAGCAAGTTATCC
AGTTTTTAAATAACAAGCATAACAGGGAGTTATGCAGAGGAGTTATTGCA
TCTGGTAACACTAATTTTGGAGATACTTTTTGTCTTGCAGGAACTGTTAT
TTCCAAAAAACTAAACGTCCCTTTGTTGTATCAGTTTGAACTTTTGGGAA
CAAAAAATGATGTAGAACAAACCCAAAAAATAATTGCCAATTTCTTTCAA
AACAGCAACTAG
50
100
150
200
250
300
350
400
450
462
View in model
Transcription unit TU_151 View in model
Empirical formula (pH 7.5) H4942C4479N1887O3214P462
Molecular weight (pH 7.5; Da) 150939.58 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
2.1 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4727400
pI 3.89
 
Comments
Comments NrdI is a flavodoxin that mediates the generation of a cofactor of NrdEF (MG_229, MG_231), a ribonucleotide reductase (rnr) which catalyzes the conversion of nucleotides to deoxyribonucleotides [PUB_0159]. NrdI increases the activity of rnr [PUB_0159]. NrdI catalyzes two step reduction of NrdF subunits of rnr needed to recycle rnr [PUB_0160].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Cotruvo JA Jr, Stubbe J. NrdI, a flavodoxin involved in maintenance of the diferric-tyrosyl radical cofactor in Escherichia coli class Ib ribonucleotide reductase. Proc Natl Acad Sci U S A 105, 14383-8 (2008). WholeCell: PUB_0160, PubMed: 18799738

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Jordan A, Aslund F, Pontis E, Reichard P, Holmgren A. Characterization of Escherichia coli NrdH. A glutaredoxin-like protein with a thioredoxin-like activity profile. J Biol Chem 272, 18044-50 (1997). WholeCell: PUB_0159, PubMed: 9218434

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:20
Last updated 2012-10-01 15:13:12