MG_225 – amino acid-polyamine-organocation (APC) permease

Name
WID MG_225 View in model
Name amino acid-polyamine-organocation (APC) permease View in model
Symbol potE2
Protein product MG_225_MONOMER
Cross references GenBank: AAC71446.1, CMR: MG_225, BioCyc: MG_225, SwissProt: P47467
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 267905274375 MG_223 MG_224 MG_225 MG_226 MG_227 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 270405 (nt), Length: 1470 (nt), Direction: Forward, G/C content: 33.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
ATGGGTCAAATCAATCGGAAGTTTAGCGAAAAGCAGTTCTTACTTTTTGT
TGTTAACTATATTGCTGGATTTGGCTTTATTGCTACTGCTATCTCACTGT
TTCGCTTAGGACCTTTTTCTTGGTTAATCTTTCTGCTTGTTAGCTTAGTT
AGTTTAATTGTTACCTTATCATTCGCACGGCTTTCATCAATAGATAGTCA
AAACTATGGTGGGCCTTATCTTTGGGCTAAGAAAGCGGTTGATAAAGAGA
AGATAGCAGGGAGAATGTTTAGCTTTTTTACGGGGTGAAATAACTTTATC
ATTGGTCCTCTTTCAGCAGCAACTGCACCACTTTTTATCCTCAATTCCTT
TAGTGGTATTGATGGGATTAGAGGTAACTTAGTTAACACTTGAATCCTAA
TTGCAATAGGTTTTTCTTTTTATGTATTACTAGCATTTATCTCAACCAAA
GGAACCTCACTAAACAAGAAACTAATAGCACTATTTGCTTCAGTAAAGTG
GATTGTGATCCTCTCAGCACTAATAGTAGCAATCTATGTTATTGCTAGAG
ATGGTAATGGTTATAGTCAAAACAATAACTTAGAAAGTGGTTTTTTTGGG
AGAAGAGAGATTAGTTTTGCACAGATAGCAACGGTATTTATTACCTTCTT
TTATTCTTATGCAGGGGTTGAAGATATCTCAGTGATGACTCCTGATGTTA
AAACTAATAACTTTAGAAAGATATTAATTGTCTCTTTTATAGCAGTTTTC
CTCTTTTATTTCATTGGGATTATTATTCTAAATGGTTTGCAAAACATTGC
TCAAAGAGGTGGGGAAGCCAATTCAATTGGTAATGTAGCGGATATCTTTA
AAAAAGCTGCTGGGCTTGGGACTTTAATCTTTTATGGAGTTGGAGCATTG
TTTAACAATGTCTCAACCAGACTTTCAACTATTATTGCCAACTCCAGAAA
GATTCTTCCGCTTGCTTATGATAACTATTTACCTAGTTTCTTTTACAAGC
AAAACAAAAAAGGTGAGTTTCAGAATGCAATTTGGTTTACCTTTGGTACT
ACTTTAATTGCAATGACTTTGCTTGTCTTTATCCCTTTAGTTGCTTCTAA
CTTTGATTTTGATAATGCTACTGAGTATGCAGCATCTGTTGGCTCAGCTG
CAACTTTGCTACAATATATTTTTGTTTTTTTTATAATCTTTAAGTTTATC
TATAAAAAAGAACCACTCTACCAGAAAAAATGGGTTAAAACAACTGAAGA
ATTATTGTTTTGTTTAGGAACAATTGTCATTGTTTTAATGTTGTTGGTTT
ATCTGTTTCCTGTTATAGATGGATTTTCAAAATGGGAAACTAAACACACA
TTAACAATTGTGTTATATGGGGTTTTAAGCCTGATAGGATTGGTACTTTT
TTTGCTCCAAGAATACAAACATAAAAACAAGCAAAATGCAAACAAACAAA
CAACCCAAACAACAGTTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1470
View in model
Transcription unit TU_149 View in model
Empirical formula (pH 7.5) H15631C14160N5730O10393P1470
Molecular weight (pH 7.5; Da) 477897.64 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
14950700
pI 4.45
 
Comments
Comments amino acid transport [PUB_0110]; may be catalytic as monomer [PUB_0245] or as dimer [PUB_0246];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Casagrande F, Ratera M, Schenk AD, Chami M, Valencia E, Lopez JM, Torrents D, Engel A, Palacin M, Fotiadis D. Projection structure of a member of the amino acid/polyamine/organocation transporter superfamily. J Biol Chem 283, 33240-8 (2008). WholeCell: PUB_0246, PubMed: 18819925

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Reig N, del Rio C, Casagrande F, Ratera M, Gelpí JL, Torrents D, Henderson PJ, Xie H, Baldwin SA, Zorzano A, Fotiadis D, Palacín M. Functional and structural characterization of the first prokaryotic member of the L-amino acid transporter (LAT) family: a model for APC transporters. J Biol Chem 282, 13270-81 (2007). WholeCell: PUB_0245, PubMed: 17344220

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:20
Last updated 2012-10-01 15:13:12