MG_224 – cell division protein FtsZ

Name
WID MG_224 View in model
Name cell division protein FtsZ View in model
Symbol ftsZ
Protein product MG_224_MONOMER
Cross references GenBank: AAC71445.1, CMR: MG_224, BioCyc: MG_224, SwissProt: P47466
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 266750272860 MG_221 MG_222 MG_223 MG_224 MG_225 MG_226 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 269250 (nt), Length: 1110 (nt), Direction: Forward, G/C content: 33.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
ATGGATGAAAATGAAACTCAATTCAACAAGTTAAACCAAGTTAAAAACAA
GCTGAAAATTGGTGTTTTTGGGATTGGAGGTGCTGGTAATAACATTGTTG
ATGCATCACTTTATCACTATCCTAATTTAGCAAGTGAAAACATCCACTTT
TATGCTATAAATTCAGATTTACAACACCTTGCATTTAAAACGAATGTTAA
AAATAAACTCTTAATTCAAGACCATACTAACAAGGGCTTTGGAGCGGGGG
GTGATCCAGCTAAAGGAGCTAGTTTAGCAATAAGCTTTCAAGAACAGTTT
AATACACTTACAGATGGGTATGATTTTTGTATCTTAGTTGCTGGATTTGG
TAAGGGTACTGGTACAGGTGCTACCCCAGTTTTTAGCAAGATCTTAAAAA
CTAAGAAGATCTTAAATGTTGCTATTGTTACCTATCCATCTTTAAACGAG
GGATTAACAGTGAGAAACAAAGCCACTAAGGGGCTTGAAATTCTCAACAA
AGCAACTGATAGTTACATGCTATTTTGTAATGAAAAATGTACAAATGGTA
TCTACCAACTAGCAAACACAGAGATAGTCAGTGCCATTAAAAACCTAATA
GAACTAATTACTATTCCTTTGCAGCAAAACATTGATTTTGAAGATGTACG
TGCCTTTTTTCAAACCAAAAAAACTAACCAAGATCAACAGCTTTTTACTG
TTACTCACCCCTTTAGTTTTAGCTTTGATAGTAAAGATAGTATAGAACAG
TTTGCTAAACAGTTTAAGAACTTTGAAAAAGTTAGTTATTTTGACCACTC
TATAGTAGGAGCTAAAAAAGTGTTATTGAAAGCTAACATTAACCAAAAGA
TAGTCAAGCTTAACTTCAAGCAGATCCAAGATATTATCTGAACTAAAATT
GACAACTACCAACTTGAGATTAGGTTAGGGGTTGATTTTGTGACAACCAT
CCCTAATATCCAAATTTTTATCCTCAGTGAACACAAAAATCCAGTTTCGC
TTCCCATTGATAATAAATCAACTGAAAACAACCAAAATAAGTTGAAACTT
TTAGATGAGCTGAAAGAACTTGGCATGAAATATGTTAAGCACCAAAACCA
AATCTACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1110
View in model
Transcription unit TU_148 View in model
Empirical formula (pH 7.5) H11882C10771N4563O7688P1110
Molecular weight (pH 7.5; Da) 362639.99 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
11457400
pI 3.81
 
Comments
Comments Benders et al characterized the transcription initiation and termination locations points of the ftsZ cell division 6 gene transcription unit, and quantitated the steady-state RNA level for each gene [PUB_0817]. Benders et al suggest cotranscription is common is M. genitalium [PUB_0817].
References
  1. Benders GA, Powell BC, Hutchison CA 3rd. Transcriptional analysis of the conserved ftsZ gene cluster in Mycoplasma genitalium and Mycoplasma pneumoniae. J Bacteriol 187, 4542-51 (2005). WholeCell: PUB_0817, PubMed: 15968065

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:20
Last updated 2012-10-01 15:13:11